EMAIL THIS PAGE TO A FRIEND

MBTPS2

membrane-bound transcription factor peptidase, site 2

71 Gene Product Result for
Synonyms: BRESEK IFAP KFSDX S2P
UniProtKB ID: O43462, Q9UM70, Q9UMD3
Gene ID:
Human(51360) Summary: This gene encodes a intramembrane zinc metalloprotease, which is essential in development. This protease functions in the signal protein activation involved in sterol control of transcription and the ER stress response. Mutations in this gene have been associated with ichthyosis follicularis with atrichia and photophobia (IFAP syndrome); IFAP syndrome has been quantitatively linked to a reduction in cholesterol homeostasis and ER stress response.[provided by RefSeq, Aug 2009]
Mouse(270669) membrane-bound transcription factor peptidase, site 2
Rat(302705) membrane-bound transcription factor peptidase, site 2
Zebrafish(334658) membrane-bound transcription factor protease, site 2
chicken(427996) membrane-bound transcription factor peptidase, site 2
cow(533134) membrane-bound transcription factor peptidase, site 2
domestic cat(101084262) membrane-bound transcription factor peptidase, site 2
dog(491771) membrane-bound transcription factor peptidase, site 2
sheep(101106915) membrane-bound transcription factor peptidase, site 2
domestic guinea pig(100713910) membrane-bound transcription factor peptidase, site 2
naked mole-rat(101726620) membrane-bound transcription factor peptidase, site 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_172307 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172307 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172307 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_015884 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015884 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015884 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015884 Rosetta Predictions human pricing
NM_001035007 Rosetta Predictions rat pricing
NM_172307 Rosetta Predictions mouse pricing
NM_178266 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015884 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00093575 predicted 1040
2 SASI_Hs01_00093576 predicted 1028
3 SASI_Hs01_00093577 predicted 1229
4 SASI_Hs01_00093578 predicted 820
5 SASI_Hs01_00093579 predicted 936
6 SASI_Hs01_00093580 predicted 1188
7 SASI_Hs01_00093582 predicted 937
8 SASI_Hs01_00093583 predicted 1177
9 SASI_Hs02_00348466 predicted 952
10 SASI_Hs02_00348467 predicted 1086
11 SASI_Hs01_00093574 predicted 1199
12 SASI_Hs01_00093581 predicted 1209
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001035007 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00204168 predicted 1070
2 SASI_Rn01_00096754 predicted 1655
3 SASI_Rn01_00096755 predicted 1072
4 SASI_Rn01_00096756 predicted 1038
5 SASI_Rn01_00096757 predicted 1540
6 SASI_Rn01_00096758 predicted 709
7 SASI_Rn02_00204169 predicted 1187
8 SASI_Rn01_00096760 predicted 1626
9 SASI_Rn01_00096761 predicted 1392
10 SASI_Rn01_00096762 predicted 1057
11 SASI_Rn01_00096753 predicted 1379
12 SASI_Rn01_00096759 predicted 953
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172307 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00152987 predicted 1111
2 SASI_Mm01_00152988 predicted 1707
3 SASI_Mm01_00152989 predicted 1338
4 SASI_Mm02_00343809 predicted 1729
5 SASI_Mm02_00343810 predicted 1714
6 SASI_Mm01_00152991 predicted 1198
7 SASI_Mm01_00152993 predicted 1075
8 SASI_Mm01_00152994 predicted 989
9 SASI_Mm01_00152995 predicted 1588
10 SASI_Mm02_00343811 predicted 749
11 SASI_Mm01_00152990 predicted 491
12 SASI_Mm01_00152992 predicted 557
13 SASI_Mm01_00152996 predicted 601
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178266 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00128997 predicted 1972
2 SASI_Mm01_00128998 predicted 1255
3 SASI_Mm01_00128999 predicted 2290
4 SASI_Mm01_00129000 predicted 2252
5 SASI_Mm01_00129001 predicted 2020
6 SASI_Mm01_00129002 predicted 1329
7 SASI_Mm01_00129003 predicted 1624
8 SASI_Mm01_00129004 predicted 1421
9 SASI_Mm01_00129005 predicted 2141
10 SASI_Mm01_00129006 predicted 1754
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172307
VALIDATED
MBTPS2 MISSION shRNA Bacterial Glycerol Stock
membrane-bound transcription factor peptidase, site 2
Mouse
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000432967    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172307.3-1675s21c1
Sequence:CCGGGATGGTTACAGCACGGTAATGCTCGAGCATTACCGTGCTGTAACCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429791    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172307.3-1307s21c1
Sequence:CCGGGAAACTCACACCCGACTAATCCTCGAGGATTAGTCGGGTGTGAGTTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416306    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172307.3-1069s21c1
Sequence:CCGGATCAACGTTACAACAATTAAGCTCGAGCTTAATTGTTGTAACGTTGATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417103    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172307.3-1598s21c1
Sequence:CCGGGTCAAAGATCTGATTGGATTTCTCGAGAAATCCAATCAGATCTTTGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423657    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172307.3-1522s21c1
Sequence:CCGGCTTTGCCTTGGATGGTCAATGCTCGAGCATTGACCATCCAAGGCAAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425626    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172307.3-1565s21c1
Sequence:CCGGGCTACCCTTACTTCAGTAATTCTCGAGAATTACTGAAGTAAGGGTAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426751    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172307.3-1875s21c1
Sequence:CCGGAGCATAATTCCTGACTATATCCTCGAGGATATAGTCAGGAATTATGCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032924    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172307.1-1270s1c1
Sequence:CCGGCCGCAAATTGATATGCTGTATCTCGAGATACAGCATATCAATTTGCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032928    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172307.1-592s1c1
Sequence:CCGGGCAGCTATTAGGGAACAAGTTCTCGAGAACTTGTTCCCTAATAGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032927    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172307.1-1372s1c1
Sequence:CCGGCCAGTGATTGTGGAGACATTTCTCGAGAAATGTCTCCACAATCACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032925    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172307.1-504s1c1
Sequence:CCGGCGGTATAAATTTACCTGTCAACTCGAGTTGACAGGTAAATTTATACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032926    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172307.1-916s1c1
Sequence:CCGGCCCGTTACTAATGTGCAAGATCTCGAGATCTTGCACATTAGTAACGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412581    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172307.3-381s21c1
Sequence:CCGGGAATGGTGTTTGGCGTGATTGCTCGAGCAATCACGCCAAACACCATTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172307
VALIDATED
MBTPS2 MISSION shRNA shRNA Plasmid DNA
membrane-bound transcription factor peptidase, site 2
Mouse
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000432967    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172307.3-1675s21c1
Sequence:CCGGGATGGTTACAGCACGGTAATGCTCGAGCATTACCGTGCTGTAACCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000429791    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172307.3-1307s21c1
Sequence:CCGGGAAACTCACACCCGACTAATCCTCGAGGATTAGTCGGGTGTGAGTTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000416306    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172307.3-1069s21c1
Sequence:CCGGATCAACGTTACAACAATTAAGCTCGAGCTTAATTGTTGTAACGTTGATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000417103    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172307.3-1598s21c1
Sequence:CCGGGTCAAAGATCTGATTGGATTTCTCGAGAAATCCAATCAGATCTTTGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000423657    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172307.3-1522s21c1
Sequence:CCGGCTTTGCCTTGGATGGTCAATGCTCGAGCATTGACCATCCAAGGCAAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000425626    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172307.3-1565s21c1
Sequence:CCGGGCTACCCTTACTTCAGTAATTCTCGAGAATTACTGAAGTAAGGGTAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000426751    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172307.3-1875s21c1
Sequence:CCGGAGCATAATTCCTGACTATATCCTCGAGGATATAGTCAGGAATTATGCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000032924    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172307.1-1270s1c1
Sequence:CCGGCCGCAAATTGATATGCTGTATCTCGAGATACAGCATATCAATTTGCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000032928    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172307.1-592s1c1
Sequence:CCGGGCAGCTATTAGGGAACAAGTTCTCGAGAACTTGTTCCCTAATAGCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000032927    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172307.1-1372s1c1
Sequence:CCGGCCAGTGATTGTGGAGACATTTCTCGAGAAATGTCTCCACAATCACTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000032925    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172307.1-504s1c1
Sequence:CCGGCGGTATAAATTTACCTGTCAACTCGAGTTGACAGGTAAATTTATACCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000032926    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172307.1-916s1c1
Sequence:CCGGCCCGTTACTAATGTGCAAGATCTCGAGATCTTGCACATTAGTAACGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000412581    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172307.3-381s21c1
Sequence:CCGGGAATGGTGTTTGGCGTGATTGCTCGAGCAATCACGCCAAACACCATTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172307
VALIDATED
MBTPS2 MISSION shRNA Lentiviral Transduction Particles
membrane-bound transcription factor peptidase, site 2
Mouse
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000432967    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172307.3-1675s21c1
Sequence:CCGGGATGGTTACAGCACGGTAATGCTCGAGCATTACCGTGCTGTAACCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429791    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172307.3-1307s21c1
Sequence:CCGGGAAACTCACACCCGACTAATCCTCGAGGATTAGTCGGGTGTGAGTTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416306    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172307.3-1069s21c1
Sequence:CCGGATCAACGTTACAACAATTAAGCTCGAGCTTAATTGTTGTAACGTTGATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417103    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172307.3-1598s21c1
Sequence:CCGGGTCAAAGATCTGATTGGATTTCTCGAGAAATCCAATCAGATCTTTGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423657    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172307.3-1522s21c1
Sequence:CCGGCTTTGCCTTGGATGGTCAATGCTCGAGCATTGACCATCCAAGGCAAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425626    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172307.3-1565s21c1
Sequence:CCGGGCTACCCTTACTTCAGTAATTCTCGAGAATTACTGAAGTAAGGGTAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426751    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172307.3-1875s21c1
Sequence:CCGGAGCATAATTCCTGACTATATCCTCGAGGATATAGTCAGGAATTATGCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032924    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172307.1-1270s1c1
Sequence:CCGGCCGCAAATTGATATGCTGTATCTCGAGATACAGCATATCAATTTGCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032928    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172307.1-592s1c1
Sequence:CCGGGCAGCTATTAGGGAACAAGTTCTCGAGAACTTGTTCCCTAATAGCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032927    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172307.1-1372s1c1
Sequence:CCGGCCAGTGATTGTGGAGACATTTCTCGAGAAATGTCTCCACAATCACTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032925    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172307.1-504s1c1
Sequence:CCGGCGGTATAAATTTACCTGTCAACTCGAGTTGACAGGTAAATTTATACCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032926    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172307.1-916s1c1
Sequence:CCGGCCCGTTACTAATGTGCAAGATCTCGAGATCTTGCACATTAGTAACGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412581    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172307.3-381s21c1
Sequence:CCGGGAATGGTGTTTGGCGTGATTGCTCGAGCAATCACGCCAAACACCATTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015884
VALIDATED
MBTPS2 MISSION shRNA Bacterial Glycerol Stock
membrane-bound transcription factor peptidase, site 2
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000280402    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015884.2-873s21c1
Sequence:CCGGCCAGTAATTCTCTTGCCATTTCTCGAGAAATGGCAAGAGAATTACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000280447    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015884.2-1080s21c1
Sequence:CCGGGCATCAACTTTACAGCAGTTACTCGAGTAACTGCTGTAAAGTTGATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343048    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015884.2-344s21c1
Sequence:CCGGGCGGAAAGCAAGGATGCTTTACTCGAGTAAAGCATCCTTGCTTTCCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016567    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_015884.1-1238s1c1
Sequence:CCGGGCTCAAGTTCAAGTTTCTGTACTCGAGTACAGAAACTTGAACTTGAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016564    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_015884.1-826s1c1
Sequence:CCGGCCAGTAATTCTCTTGCCATTTCTCGAGAAATGGCAAGAGAATTACTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016563    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1 Clone ID:NM_015884.1-556s1c1
Sequence:CCGGCCCGTCAATCAACTGACCTATCTCGAGATAGGTCAGTTGATTGACGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016566    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_015884.1-297s1c1
Sequence:CCGGGCGGAAAGCAAGGATGCTTTACTCGAGTAAAGCATCCTTGCTTTCCGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000297294    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015884.2-1285s21c1
Sequence:CCGGGCTCAAGTTCAAGTTTCTGTACTCGAGTACAGAAACTTGAACTTGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015884
VALIDATED
MBTPS2 MISSION shRNA shRNA Plasmid DNA
membrane-bound transcription factor peptidase, site 2
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000280402    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015884.2-873s21c1
Sequence:CCGGCCAGTAATTCTCTTGCCATTTCTCGAGAAATGGCAAGAGAATTACTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000280447    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015884.2-1080s21c1
Sequence:CCGGGCATCAACTTTACAGCAGTTACTCGAGTAACTGCTGTAAAGTTGATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000343048    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015884.2-344s21c1
Sequence:CCGGGCGGAAAGCAAGGATGCTTTACTCGAGTAAAGCATCCTTGCTTTCCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000016567    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_015884.1-1238s1c1
Sequence:CCGGGCTCAAGTTCAAGTTTCTGTACTCGAGTACAGAAACTTGAACTTGAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000016564    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_015884.1-826s1c1
Sequence:CCGGCCAGTAATTCTCTTGCCATTTCTCGAGAAATGGCAAGAGAATTACTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000016563    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1 Clone ID:NM_015884.1-556s1c1
Sequence:CCGGCCCGTCAATCAACTGACCTATCTCGAGATAGGTCAGTTGATTGACGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000016566    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_015884.1-297s1c1
Sequence:CCGGGCGGAAAGCAAGGATGCTTTACTCGAGTAAAGCATCCTTGCTTTCCGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000297294    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015884.2-1285s21c1
Sequence:CCGGGCTCAAGTTCAAGTTTCTGTACTCGAGTACAGAAACTTGAACTTGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015884
VALIDATED
MBTPS2 MISSION shRNA Lentiviral Transduction Particles
membrane-bound transcription factor peptidase, site 2
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000280402    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015884.2-873s21c1
Sequence:CCGGCCAGTAATTCTCTTGCCATTTCTCGAGAAATGGCAAGAGAATTACTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000280447    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015884.2-1080s21c1
Sequence:CCGGGCATCAACTTTACAGCAGTTACTCGAGTAACTGCTGTAAAGTTGATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343048    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015884.2-344s21c1
Sequence:CCGGGCGGAAAGCAAGGATGCTTTACTCGAGTAAAGCATCCTTGCTTTCCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016567    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_015884.1-1238s1c1
Sequence:CCGGGCTCAAGTTCAAGTTTCTGTACTCGAGTACAGAAACTTGAACTTGAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016564    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_015884.1-826s1c1
Sequence:CCGGCCAGTAATTCTCTTGCCATTTCTCGAGAAATGGCAAGAGAATTACTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016563    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1 Clone ID:NM_015884.1-556s1c1
Sequence:CCGGCCCGTCAATCAACTGACCTATCTCGAGATAGGTCAGTTGATTGACGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016566    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_015884.1-297s1c1
Sequence:CCGGGCGGAAAGCAAGGATGCTTTACTCGAGTAAAGCATCCTTGCTTTCCGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000297294    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015884.2-1285s21c1
Sequence:CCGGGCTCAAGTTCAAGTTTCTGTACTCGAGTACAGAAACTTGAACTTGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)