EMAIL THIS PAGE TO A FRIEND

MC1R

melanocortin 1 receptor (alpha melanocyte stimulating hormone receptor)

62 Gene Product Result for
Synonyms: CMM5 MSH-R SHEP2
Gene ID:
Human(4157) Summary: This intronless gene encodes the receptor protein for melanocyte-stimulating hormone (MSH). The encoded protein, a seven pass transmembrane G protein coupled receptor, controls melanogenesis. Two types of melanin exist: red pheomelanin and black eumelanin. Gene mutations that lead to a loss in function are associated with increased pheomelanin production, which leads to lighter skin and hair color. Eumelanin is photoprotective but pheomelanin may contribute to UV-induced skin damage by generating free radicals upon UV radiation. Binding of MSH to its receptor activates the receptor and stimulates eumelanin synthesis. This receptor is a major determining factor in sun sensitivity and is a genetic risk factor for melanoma and non-melanoma skin cancer. Over 30 variant alleles have been identified which correlate with skin and hair color, providing evidence that this gene is an important component in determining normal human pigment variation. [provided by RefSeq, Jul 2008]
Mouse(17199) melanocortin 1 receptor
Rat(292083) melanocortin 1 receptor
Goat(100750239) melanocortin 1 receptor (alpha melanocyte stimulating hormone receptor)
sheep(102099064) melanocortin 1 receptor
naked mole-rat(101726602) melanocortin 1 receptor (alpha melanocyte stimulating hormone receptor)
Domestic Rabbit(100340038) melanocortin 1 receptor (alpha melanocyte stimulating hormone receptor)
Zebrafish(353151) melanocortin 1 receptor
cow(281298) melanocortin 1 receptor (alpha melanocyte stimulating hormone receptor)
Horse(100136907) melanocortin 1 receptor (alpha melanocyte stimulating hormone receptor)
domestic cat(493917) melanocortin 1 receptor (alpha melanocyte stimulating hormone receptor)
dog(489652) melanocortin 1 receptor (alpha melanocyte stimulating hormone receptor)
chicken(427562) melanocortin 1 receptor (alpha melanocyte stimulating hormone receptor)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_008559 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008559 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008559 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_002386 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002386 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002386 MISSION® shRNA Lentiviral Transduction Particles human pricing

Related Products

Product # Description Species Add to Cart
 
AB9354 Anti-Beta III Tubulin Antibody Anti-Beta III Tubulin Antibody detects level of Beta III Tubulin & has been published & validated for use in IC, IH & WB. pricing
AB15708A4 Anti-Beta III Tubulin Antibody, Alexa Fluor® 488 Conjugate | AB15708A4 pricing
AB15708B Anti-Beta III Tubulin, Biotin conjugate Antibody Anti-Beta III Tubulin, Biotin conjugate Antibody detects level of Beta III Tubulin & has been published & validated for use in ICC. pricing
AB15708C3 Anti-Beta III Tubulin, Cy3 Conjugate Antibody This Anti-Beta III Tubulin, Cy3 Conjugate Antibody is validated for use in ICC for the detection of Beta III Tubulin. pricing
AB15708 Anti-β III tubulin Antibody Anti-β III tubulin Antibody is an antibody against β III tubulin for use in WB. pricing
AB5126 Anti-Melanocortin Receptor-1 Antibody Anti-Melanocortin Receptor-1 Antibody is an antibody against Melanocortin Receptor-1 for use in ELISA & WB. pricing
MAB3408 Anti-Tubulin Antibody, beta, clone KMX-1 This Anti-Tubulin Antibody, beta, clone KMX-1 is validated for use in IC, WB for the detection of Tubulin. pricing
MAB1637 Anti-Tubulin Antibody, beta III isoform, CT, clone TU-20 (Similar to TUJ1) Anti-Tubulin Antibody, beta III isoform, C-terminus, clone TU-20 (Similar to TUJ1) is an antibody against Tubulin for use in ELISA, IC, IH, IH(P), IP & WB with more than 55 product citations. pricing
MAB380 Anti-Tubulin β Antibody, clone 5H1 Anti-Tubulin Antibody, β, clone 5H1 is an antibody against Tubulin for use in IH. pricing
AB3201 Anti-Tubulin Antibody, Detyrosinated Anti-Tubulin Antibody, Detyrosinated is an antibody against Tubulin for use in IC, IH(P) and WB. pricing
MAB5562 Anti-Tubulin β II Antibody Detect Tubulin using this Anti-Tubulin Antibody, β II validated for use in WB, IH. pricing
MAB5564 Anti-Tubulin β III Antibody Anti-Tubulin Antibody, β III detects level of Tubulin & has been published & validated for use in WB, IH. pricing
05-559 Anti-Tubulin βIII Antibody, clone 2G10, neuronal Anti-Tubulin βIII Antibody, clone 2G10, neuronal is an antibody against Tubulin βIII for use in WB & IC. pricing
CBL412X Anti-Tubulin β-III Antibody, clone TU-20, Alexa Fluor®488 Conjugated Detect Tubulin β-III using this Anti-Tubulin β-III Antibody, clone TU-20, Alexa Fluor®488 Conjugated validated for use in IC, IF, WB, IH & IP. pricing
CBL412A5 Anti-Tubulin β-III Antibody, clone TU-20, Alexa Fluor®555 Conjugate Detect Tubulin β-III using this Anti-Tubulin β-III Antibody, clone TU-20, Alexa Fluor®555 Conjugate validated for use in ICC. pricing
HTS156M ChemiSCREEN™ Membrane Preparation Recombinant Human MC1 Melanocortin Receptor Human MC1 GPCR membrane preparation for Radioligand binding Assays & GTPγS binding. pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002386 Rosetta Predictions human pricing
NM_008559 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002386 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00133529 predicted 2057
2 SASI_Hs02_00333734 predicted 2087
3 SASI_Hs02_00333735 predicted 2017
4 SASI_Hs02_00333736 predicted 2022
5 SASI_Hs02_00333737 predicted 2059
6 SASI_Hs01_00133530 predicted 1062
7 SASI_Hs02_00333738 predicted 1362
8 SASI_Hs01_00133531 predicted 845
9 SASI_Hs01_00133532 predicted 784
10 SASI_Hs01_00133533 predicted 658
11 SASI_Hs01_00133534 predicted 1413
12 SASI_Hs01_00133535 predicted 1166
13 SASI_Hs01_00133536 predicted 1990
14 SASI_Hs01_00133537 predicted 1139
15 SASI_Hs01_00133538 predicted 836
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008559 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00314154 predicted 1609
2 SASI_Mm01_00174750 predicted 1018
3 SASI_Mm02_00314155 predicted 1467
4 SASI_Mm02_00314156 predicted 589
5 SASI_Mm01_00174754 predicted 687
6 SASI_Mm01_00174755 predicted 912
7 SASI_Mm02_00314157 predicted 1513
8 SASI_Mm01_00174756 predicted 659
9 SASI_Mm02_00314158 predicted 578
10 SASI_Mm01_00174758 predicted 1027
11 SASI_Mm01_00174749 predicted 696
12 SASI_Mm01_00174751 predicted 609
13 SASI_Mm01_00174752 predicted 1030
14 SASI_Mm01_00174753 predicted 1026
15 SASI_Mm01_00174757 predicted 255
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008559
VALIDATED
MC1R MISSION shRNA Bacterial Glycerol Stock
melanocortin 1 receptor (alpha melanocyte stimulating hormone receptor)
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000362521    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_008559.2-817s21c1
Sequence:CCGGTCTGCTTCCTGGGCATCATTGCTCGAGCAATGATGCCCAGGAAGCAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000362435    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_008559.2-693s21c1
Sequence:CCGGATCGTGCTGGAGACTACTATCCTCGAGGATAGTAGTCTCCAGCACGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028390    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008559.1-260s1c1
Sequence:CCGGCCTGATGGTAAGTGTCAGCATCTCGAGATGCTGACACTTACCATCAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028309    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_008559.1-1030s1c1
Sequence:CCGGCATCCCTTCCTGATCTCCATTCTCGAGAATGGAGATCAGGAAGGGATGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028382    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008559.1-584s1c1
Sequence:CCGGCGTCACTTTCTTTCTAGCCATCTCGAGATGGCTAGAAAGAAAGTGACGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028322    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008559.1-281s1c1
Sequence:CCGGCGTGCTGGAGACTACTATCATCTCGAGATGATAGTAGTCTCCAGCACGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028335    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_008559.1-171s1c1
Sequence:CCGGGAGAATGTGCTGGTTGTGATACTCGAGTATCACAACCAGCACATTCTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000368831    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_008559.2-941s21c1
Sequence:CCGGCGTCTCCAGCACCCTCTTTATCTCGAGATAAAGAGGGTGCTGGAGACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000362433    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_008559.2-631s21c1
Sequence:CCGGACTCGCCCATGTATTACTTCACTCGAGTGAAGTAATACATGGGCGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000362434    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_008559.2-858s21c1
Sequence:CCGGATCTTCTATGCGCTGCGTTATCTCGAGATAACGCAGCGCATAGAAGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008559
VALIDATED
MC1R MISSION shRNA shRNA Plasmid DNA
melanocortin 1 receptor (alpha melanocyte stimulating hormone receptor)
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000362521    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_008559.2-817s21c1
Sequence:CCGGTCTGCTTCCTGGGCATCATTGCTCGAGCAATGATGCCCAGGAAGCAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000362435    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_008559.2-693s21c1
Sequence:CCGGATCGTGCTGGAGACTACTATCCTCGAGGATAGTAGTCTCCAGCACGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000028390    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008559.1-260s1c1
Sequence:CCGGCCTGATGGTAAGTGTCAGCATCTCGAGATGCTGACACTTACCATCAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000028309    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_008559.1-1030s1c1
Sequence:CCGGCATCCCTTCCTGATCTCCATTCTCGAGAATGGAGATCAGGAAGGGATGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000028382    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008559.1-584s1c1
Sequence:CCGGCGTCACTTTCTTTCTAGCCATCTCGAGATGGCTAGAAAGAAAGTGACGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000028322    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008559.1-281s1c1
Sequence:CCGGCGTGCTGGAGACTACTATCATCTCGAGATGATAGTAGTCTCCAGCACGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000028335    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_008559.1-171s1c1
Sequence:CCGGGAGAATGTGCTGGTTGTGATACTCGAGTATCACAACCAGCACATTCTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000368831    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_008559.2-941s21c1
Sequence:CCGGCGTCTCCAGCACCCTCTTTATCTCGAGATAAAGAGGGTGCTGGAGACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000362433    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_008559.2-631s21c1
Sequence:CCGGACTCGCCCATGTATTACTTCACTCGAGTGAAGTAATACATGGGCGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000362434    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_008559.2-858s21c1
Sequence:CCGGATCTTCTATGCGCTGCGTTATCTCGAGATAACGCAGCGCATAGAAGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008559
VALIDATED
MC1R MISSION shRNA Lentiviral Transduction Particles
melanocortin 1 receptor (alpha melanocyte stimulating hormone receptor)
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000362521    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_008559.2-817s21c1
Sequence:CCGGTCTGCTTCCTGGGCATCATTGCTCGAGCAATGATGCCCAGGAAGCAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000362435    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_008559.2-693s21c1
Sequence:CCGGATCGTGCTGGAGACTACTATCCTCGAGGATAGTAGTCTCCAGCACGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028390    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008559.1-260s1c1
Sequence:CCGGCCTGATGGTAAGTGTCAGCATCTCGAGATGCTGACACTTACCATCAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028309    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_008559.1-1030s1c1
Sequence:CCGGCATCCCTTCCTGATCTCCATTCTCGAGAATGGAGATCAGGAAGGGATGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028382    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008559.1-584s1c1
Sequence:CCGGCGTCACTTTCTTTCTAGCCATCTCGAGATGGCTAGAAAGAAAGTGACGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028322    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008559.1-281s1c1
Sequence:CCGGCGTGCTGGAGACTACTATCATCTCGAGATGATAGTAGTCTCCAGCACGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028335    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_008559.1-171s1c1
Sequence:CCGGGAGAATGTGCTGGTTGTGATACTCGAGTATCACAACCAGCACATTCTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000368831    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_008559.2-941s21c1
Sequence:CCGGCGTCTCCAGCACCCTCTTTATCTCGAGATAAAGAGGGTGCTGGAGACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000362433    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_008559.2-631s21c1
Sequence:CCGGACTCGCCCATGTATTACTTCACTCGAGTGAAGTAATACATGGGCGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000362434    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_008559.2-858s21c1
Sequence:CCGGATCTTCTATGCGCTGCGTTATCTCGAGATAACGCAGCGCATAGAAGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002386
VALIDATED
MC1R MISSION shRNA Bacterial Glycerol Stock
melanocortin 1 receptor (alpha melanocyte stimulating hormone receptor)
Human
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000357614    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002386.3-1908s21c1
Sequence:CCGGCACGCTCTTCATCGCCTACTACTCGAGTAGTAGGCGATGAAGAGCGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357611    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002386.3-1957s21c1
Sequence:CCGGGTGGTCTTCTTCCTGGCTATGCTCGAGCATAGCCAGGAAGAAGACCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011745    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002386.2-1160s1c1
Sequence:CCGGCGTCTTCAGCACGCTCTTCATCTCGAGATGAAGAGCGTGCTGAAGACGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011742    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002386.2-1878s1c1
Sequence:CCGGCAGGCTCCTAAAGAGACATTTCTCGAGAAATGTCTCTTTAGGAGCCTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011746    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002386.2-1064s1c1
Sequence:CCGGCCGCTACATCTCCATCTTCTACTCGAGTAGAAGATGGAGATGTAGCGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357610    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002386.3-2074s21c1
Sequence:CCGGCACCAGGGCTTTGGCCTTAAACTCGAGTTTAAGGCCAAAGCCCTGGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011744    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_002386.2-1469s1c1
Sequence:CCGGCTTCAAGAACTTCAACCTCTTCTCGAGAAGAGGTTGAAGTTCTTGAAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011743    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002386.2-1217s1c1
Sequence:CCGGCGTGGTCTTCTTCCTGGCTATCTCGAGATAGCCAGGAAGAAGACCACGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357613    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002386.3-2108s21c1
Sequence:CCGGTCACCATCCTGCTGGGCATTTCTCGAGAAATGCCCAGCAGGATGGTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357545    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 2 Clone ID:NM_002386.3-2220s21c1
Sequence:CCGGCAACCTCTTTCTCGCCCTCATCTCGAGATGAGGGCGAGAAAGAGGTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357543    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002386.3-1730s21c1
Sequence:CCGGACAATGTCATTGACGTGATCACTCGAGTGATCACGTCAATGACATTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357612    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002386.3-2444s21c1
Sequence:CCGGTCAAAGAGGATGGACTAAATGCTCGAGCATTTAGTCCATCCTCTTTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000368496    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002386.3-2366s21c1
Sequence:CCGGCAGAGGGAGGTGGTGATATTGCTCGAGCAATATCACCACCTCCCTCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357609    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_002386.3-2197s21c1
Sequence:CCGGTGCGGCTGCATCTTCAAGAACCTCGAGGTTCTTGAAGATGCAGCCGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002386
VALIDATED
MC1R MISSION shRNA shRNA Plasmid DNA
melanocortin 1 receptor (alpha melanocyte stimulating hormone receptor)
Human
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000357614    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002386.3-1908s21c1
Sequence:CCGGCACGCTCTTCATCGCCTACTACTCGAGTAGTAGGCGATGAAGAGCGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000357611    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002386.3-1957s21c1
Sequence:CCGGGTGGTCTTCTTCCTGGCTATGCTCGAGCATAGCCAGGAAGAAGACCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000011745    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002386.2-1160s1c1
Sequence:CCGGCGTCTTCAGCACGCTCTTCATCTCGAGATGAAGAGCGTGCTGAAGACGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000011742    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002386.2-1878s1c1
Sequence:CCGGCAGGCTCCTAAAGAGACATTTCTCGAGAAATGTCTCTTTAGGAGCCTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000011746    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002386.2-1064s1c1
Sequence:CCGGCCGCTACATCTCCATCTTCTACTCGAGTAGAAGATGGAGATGTAGCGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000357610    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002386.3-2074s21c1
Sequence:CCGGCACCAGGGCTTTGGCCTTAAACTCGAGTTTAAGGCCAAAGCCCTGGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000011744    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_002386.2-1469s1c1
Sequence:CCGGCTTCAAGAACTTCAACCTCTTCTCGAGAAGAGGTTGAAGTTCTTGAAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000011743    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002386.2-1217s1c1
Sequence:CCGGCGTGGTCTTCTTCCTGGCTATCTCGAGATAGCCAGGAAGAAGACCACGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000357613    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002386.3-2108s21c1
Sequence:CCGGTCACCATCCTGCTGGGCATTTCTCGAGAAATGCCCAGCAGGATGGTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000357545    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 2 Clone ID:NM_002386.3-2220s21c1
Sequence:CCGGCAACCTCTTTCTCGCCCTCATCTCGAGATGAGGGCGAGAAAGAGGTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000357543    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002386.3-1730s21c1
Sequence:CCGGACAATGTCATTGACGTGATCACTCGAGTGATCACGTCAATGACATTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000357612    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002386.3-2444s21c1
Sequence:CCGGTCAAAGAGGATGGACTAAATGCTCGAGCATTTAGTCCATCCTCTTTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000368496    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002386.3-2366s21c1
Sequence:CCGGCAGAGGGAGGTGGTGATATTGCTCGAGCAATATCACCACCTCCCTCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000357609    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_002386.3-2197s21c1
Sequence:CCGGTGCGGCTGCATCTTCAAGAACCTCGAGGTTCTTGAAGATGCAGCCGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002386
VALIDATED
MC1R MISSION shRNA Lentiviral Transduction Particles
melanocortin 1 receptor (alpha melanocyte stimulating hormone receptor)
Human
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000357614    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002386.3-1908s21c1
Sequence:CCGGCACGCTCTTCATCGCCTACTACTCGAGTAGTAGGCGATGAAGAGCGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357611    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002386.3-1957s21c1
Sequence:CCGGGTGGTCTTCTTCCTGGCTATGCTCGAGCATAGCCAGGAAGAAGACCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011745    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002386.2-1160s1c1
Sequence:CCGGCGTCTTCAGCACGCTCTTCATCTCGAGATGAAGAGCGTGCTGAAGACGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011742    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002386.2-1878s1c1
Sequence:CCGGCAGGCTCCTAAAGAGACATTTCTCGAGAAATGTCTCTTTAGGAGCCTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011746    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002386.2-1064s1c1
Sequence:CCGGCCGCTACATCTCCATCTTCTACTCGAGTAGAAGATGGAGATGTAGCGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357610    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002386.3-2074s21c1
Sequence:CCGGCACCAGGGCTTTGGCCTTAAACTCGAGTTTAAGGCCAAAGCCCTGGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011744    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_002386.2-1469s1c1
Sequence:CCGGCTTCAAGAACTTCAACCTCTTCTCGAGAAGAGGTTGAAGTTCTTGAAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011743    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002386.2-1217s1c1
Sequence:CCGGCGTGGTCTTCTTCCTGGCTATCTCGAGATAGCCAGGAAGAAGACCACGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357613    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002386.3-2108s21c1
Sequence:CCGGTCACCATCCTGCTGGGCATTTCTCGAGAAATGCCCAGCAGGATGGTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357545    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 2 Clone ID:NM_002386.3-2220s21c1
Sequence:CCGGCAACCTCTTTCTCGCCCTCATCTCGAGATGAGGGCGAGAAAGAGGTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357543    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002386.3-1730s21c1
Sequence:CCGGACAATGTCATTGACGTGATCACTCGAGTGATCACGTCAATGACATTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357612    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002386.3-2444s21c1
Sequence:CCGGTCAAAGAGGATGGACTAAATGCTCGAGCATTTAGTCCATCCTCTTTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000368496    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002386.3-2366s21c1
Sequence:CCGGCAGAGGGAGGTGGTGATATTGCTCGAGCAATATCACCACCTCCCTCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357609    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_002386.3-2197s21c1
Sequence:CCGGTGCGGCTGCATCTTCAAGAACCTCGAGGTTCTTGAAGATGCAGCCGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)