EMAIL THIS PAGE TO A FRIEND

MC2R

melanocortin 2 receptor (adrenocorticotropic hormone)

71 Gene Product Result for
Synonyms: ACTHR
UniProtKB ID: Q01718, A8K016, Q3MI45, Q504X6
Gene ID:
Human(4158) Summary: MC2R encodes one member of the five-member G-protein associated melanocortin receptor family. Melanocortins (melanocyte-stimulating hormones and adrenocorticotropic hormone) are peptides derived from pro-opiomelanocortin (POMC). MC2R is selectively activated by adrenocorticotropic hormone, whereas the other four melanocortin receptors recognize a variety of melanocortin ligands. Mutations in MC2R can result in familial glucocorticoid deficiency. [provided by RefSeq, Jul 2008]
Mouse(17200) melanocortin 2 receptor
Rat(282839) melanocortin 2 receptor (adrenocorticotropic hormone)
Zebrafish(353152) melanocortin 2 receptor
chicken(428516) melanocortin 2 receptor (adrenocorticotropic hormone)
cow(281299) melanocortin 2 receptor (adrenocorticotropic hormone)
dog(483980) melanocortin 2 receptor (adrenocorticotropic hormone)
domestic guinea pig(100135574) melanocortin 2 receptor
naked mole-rat(101699946) melanocortin 2 receptor (adrenocorticotropic hormone)
sheep(443482) melanocortin 2 receptor (adrenocorticotropic hormone)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_008560 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008560 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008560 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_000529 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000529 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000529 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU020421 MISSION® esiRNA esiRNA targeting mouse Mc2r (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000529 Rosetta Predictions human pricing
XM_001067549 Rosetta Predictions rat pricing
XM_574167 Rosetta Predictions rat pricing
NM_008560 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000529 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00170263 predicted 651
2 SASI_Hs01_00170264 predicted 384
3 SASI_Hs01_00170265 predicted 682
4 SASI_Hs01_00170266 predicted 233
5 SASI_Hs01_00170267 predicted 377
6 SASI_Hs01_00170268 predicted 1014
7 SASI_Hs01_00170269 predicted 367
8 SASI_Hs01_00170270 predicted 212
9 SASI_Hs01_00170271 predicted 492
10 SASI_Hs01_00170272 predicted 672
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001067549 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00321352 predicted 439
2 SASI_Rn02_00321353 predicted 202
3 SASI_Rn02_00321354 predicted 570
4 SASI_Rn02_00321355 predicted 697
5 SASI_Rn02_00321356 predicted 219
6 SASI_Rn02_00321357 predicted 401
7 SASI_Rn02_00321358 predicted 447
8 SASI_Rn02_00321359 predicted 449
9 SASI_Rn02_00321360 predicted 476
10 SASI_Rn02_00321361 predicted 620
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_574167 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00401505 predicted 431
2 SASI_Rn02_00401506 predicted 207
3 SASI_Rn02_00401507 predicted 571
4 SASI_Rn02_00401508 predicted 689
5 SASI_Rn02_00401509 predicted 213
6 SASI_Rn02_00401510 predicted 399
7 SASI_Rn02_00401511 predicted 447
8 SASI_Rn02_00401512 predicted 452
9 SASI_Rn02_00401513 predicted 477
10 SASI_Rn02_00401514 predicted 619
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008560 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00057067 predicted 359
2 SASI_Mm01_00057068 predicted 1004
3 SASI_Mm01_00057069 predicted 997
4 SASI_Mm01_00057070 predicted 461
5 SASI_Mm01_00057071 predicted 510
6 SASI_Mm01_00057072 predicted 471
7 SASI_Mm01_00057073 predicted 986
8 SASI_Mm01_00057074 predicted 569
9 SASI_Mm01_00057076 predicted 456
10 SASI_Mm02_00314159 predicted 1155
11 SASI_Mm01_00057075 predicted 443
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008560
MC2R MISSION shRNA Bacterial Glycerol Stock
melanocortin 2 receptor (adrenocorticotropic hormone)
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000433477    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008560.2-441s21c1
Sequence:CCGGTCATCTGCAGTTTGGCCATTTCTCGAGAAATGGCCAAACTGCAGATGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420820    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008560.2-1135s21c1
Sequence:CCGGCAACCGGTATTAGTAGAATTTCTCGAGAAATTCTACTAATACCGGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026305    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008560.2-659s1c1
Sequence:CCGGGCCCTGCAATACCATAGCATTCTCGAGAATGCTATGGTATTGCAGGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417143    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008560.2-623s21c1
Sequence:CCGGGTCATTGCAGCTGACCGTTACCTCGAGGTAACGGTCAGCTGCAATGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026315    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008560.2-1161s1c1
Sequence:CCGGCCCTGCTTTGAGTGTTGTAAACTCGAGTTTACAACACTCAAAGCAGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026287    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008560.2-297s1c1
Sequence:CCGGCCGCAAGAAATAACTCCGATTCTCGAGAATCGGAGTTATTTCTTGCGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026265    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008560.2-706s1c1
Sequence:CCGGCCTAACAATTATCTGGATGTTCTCGAGAACATCCAGATAATTGTTAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008560
MC2R MISSION shRNA shRNA Plasmid DNA
melanocortin 2 receptor (adrenocorticotropic hormone)
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000433477    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008560.2-441s21c1
Sequence:CCGGTCATCTGCAGTTTGGCCATTTCTCGAGAAATGGCCAAACTGCAGATGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000420820    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008560.2-1135s21c1
Sequence:CCGGCAACCGGTATTAGTAGAATTTCTCGAGAAATTCTACTAATACCGGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000026305    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008560.2-659s1c1
Sequence:CCGGGCCCTGCAATACCATAGCATTCTCGAGAATGCTATGGTATTGCAGGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000417143    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008560.2-623s21c1
Sequence:CCGGGTCATTGCAGCTGACCGTTACCTCGAGGTAACGGTCAGCTGCAATGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000026315    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008560.2-1161s1c1
Sequence:CCGGCCCTGCTTTGAGTGTTGTAAACTCGAGTTTACAACACTCAAAGCAGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000026287    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008560.2-297s1c1
Sequence:CCGGCCGCAAGAAATAACTCCGATTCTCGAGAATCGGAGTTATTTCTTGCGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000026265    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008560.2-706s1c1
Sequence:CCGGCCTAACAATTATCTGGATGTTCTCGAGAACATCCAGATAATTGTTAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008560
MC2R MISSION shRNA Lentiviral Transduction Particles
melanocortin 2 receptor (adrenocorticotropic hormone)
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000433477    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008560.2-441s21c1
Sequence:CCGGTCATCTGCAGTTTGGCCATTTCTCGAGAAATGGCCAAACTGCAGATGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420820    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008560.2-1135s21c1
Sequence:CCGGCAACCGGTATTAGTAGAATTTCTCGAGAAATTCTACTAATACCGGTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026305    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008560.2-659s1c1
Sequence:CCGGGCCCTGCAATACCATAGCATTCTCGAGAATGCTATGGTATTGCAGGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417143    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008560.2-623s21c1
Sequence:CCGGGTCATTGCAGCTGACCGTTACCTCGAGGTAACGGTCAGCTGCAATGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026315    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008560.2-1161s1c1
Sequence:CCGGCCCTGCTTTGAGTGTTGTAAACTCGAGTTTACAACACTCAAAGCAGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026287    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008560.2-297s1c1
Sequence:CCGGCCGCAAGAAATAACTCCGATTCTCGAGAATCGGAGTTATTTCTTGCGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026265    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008560.2-706s1c1
Sequence:CCGGCCTAACAATTATCTGGATGTTCTCGAGAACATCCAGATAATTGTTAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000529
MC2R MISSION shRNA Bacterial Glycerol Stock
melanocortin 2 receptor (adrenocorticotropic hormone)
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000357548    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000529.2-1224s21c1
Sequence:CCGGGTTCTATGTGAACAGTCTTATCTCGAGATAAGACTGTTCACATAGAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011750    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000529.1-723s1c1
Sequence:CCGGGATGACATTCTGCCCAAGTAACTCGAGTTACTTGGGCAGAATGTCATCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011751    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000529.1-310s1c1
Sequence:CCGGGACATCATCGACTCCCTGTTTCTCGAGAAACAGGGAGTCGATGATGTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011747    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000529.1-142s1c1
Sequence:CCGGGCTGTGTTCAAGAATAAGAATCTCGAGATTCTTATTCTTGAACACAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011749    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000529.1-246s1c1
Sequence:CCGGCCTGATCATATTGAGAAACATCTCGAGATGTTTCTCAATATGATCAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357616    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000529.2-386s21c1
Sequence:CCGGATATGCTGGGCAGCCTATATACTCGAGTATATAGGCTGCCCAGCATATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357546    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000529.2-1108s21c1
Sequence:CCGGACGTTGCCAAGTGCCAGAATACTCGAGTATTCTGGCACTTGGCAACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000529
MC2R MISSION shRNA shRNA Plasmid DNA
melanocortin 2 receptor (adrenocorticotropic hormone)
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000357548    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000529.2-1224s21c1
Sequence:CCGGGTTCTATGTGAACAGTCTTATCTCGAGATAAGACTGTTCACATAGAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000011750    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000529.1-723s1c1
Sequence:CCGGGATGACATTCTGCCCAAGTAACTCGAGTTACTTGGGCAGAATGTCATCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000011751    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000529.1-310s1c1
Sequence:CCGGGACATCATCGACTCCCTGTTTCTCGAGAAACAGGGAGTCGATGATGTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000011747    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000529.1-142s1c1
Sequence:CCGGGCTGTGTTCAAGAATAAGAATCTCGAGATTCTTATTCTTGAACACAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000011749    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000529.1-246s1c1
Sequence:CCGGCCTGATCATATTGAGAAACATCTCGAGATGTTTCTCAATATGATCAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000357616    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000529.2-386s21c1
Sequence:CCGGATATGCTGGGCAGCCTATATACTCGAGTATATAGGCTGCCCAGCATATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000357546    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000529.2-1108s21c1
Sequence:CCGGACGTTGCCAAGTGCCAGAATACTCGAGTATTCTGGCACTTGGCAACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000529
MC2R MISSION shRNA Lentiviral Transduction Particles
melanocortin 2 receptor (adrenocorticotropic hormone)
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000357548    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000529.2-1224s21c1
Sequence:CCGGGTTCTATGTGAACAGTCTTATCTCGAGATAAGACTGTTCACATAGAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011750    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000529.1-723s1c1
Sequence:CCGGGATGACATTCTGCCCAAGTAACTCGAGTTACTTGGGCAGAATGTCATCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011751    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000529.1-310s1c1
Sequence:CCGGGACATCATCGACTCCCTGTTTCTCGAGAAACAGGGAGTCGATGATGTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011747    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000529.1-142s1c1
Sequence:CCGGGCTGTGTTCAAGAATAAGAATCTCGAGATTCTTATTCTTGAACACAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011749    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000529.1-246s1c1
Sequence:CCGGCCTGATCATATTGAGAAACATCTCGAGATGTTTCTCAATATGATCAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357616    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000529.2-386s21c1
Sequence:CCGGATATGCTGGGCAGCCTATATACTCGAGTATATAGGCTGCCCAGCATATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357546    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000529.2-1108s21c1
Sequence:CCGGACGTTGCCAAGTGCCAGAATACTCGAGTATTCTGGCACTTGGCAACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)