EMAIL THIS PAGE TO A FRIEND

MC3R

melanocortin 3 receptor

50 Gene Product Result for
Synonyms: BMIQ9 MC3 MC3-R OB20 OQTL
UniProtKB ID: P41968, Q4KN27, Q9H517
Gene ID:
Human(4159) Summary: This gene encodes a G-protein-coupled receptor for melanocyte-stimulating hormone and adrenocorticotropic hormone that is expressed in tissues other than the adrenal cortex and melanocytes. This gene maps to the same region as the locus for benign neonatal epilepsy. Mice deficient for this gene have increased fat mass despite decreased food intake, suggesting a role for this gene product in the regulation of energy homeostasis. Mutations in this gene are associated with a susceptibility to obesity in humans. [provided by RefSeq, Jul 2008]
Mouse(17201) melanocortin 3 receptor
Rat(29310) melanocortin 3 receptor
Zebrafish(353153) melanocortin 3 receptor
cow(505405) melanocortin 3 receptor
Horse(100054477) melanocortin 3 receptor
domestic cat(101091434) melanocortin 3 receptor
dog(485938) melanocortin 3 receptor
sheep(101119579) melanocortin 3 receptor
naked mole-rat(101712663) melanocortin 3 receptor
domestic guinea pig(100720674) melanocortin 3 receptor
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Agonist

Product # Description Species Add to Cart
 
M8693 Melanotan II acetate salt ≥95% (HPLC) human, mouse, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_019888 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_019888 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_019888 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008561 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008561 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008561 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU150201 MISSION® esiRNA esiRNA human MC3R (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_019888 Rosetta Predictions human pricing
NM_001025270 Rosetta Predictions rat pricing
NM_008561 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019888 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00039815 predicted 665
2 SASI_Hs01_00039816 predicted 799
3 SASI_Hs01_00039817 predicted 252
4 SASI_Hs01_00039818 predicted 460
5 SASI_Hs01_00039819 predicted 843
6 SASI_Hs01_00039820 predicted 426
7 SASI_Hs01_00039821 predicted 356
8 SASI_Hs01_00039822 predicted 351
9 SASI_Hs01_00039823 predicted 832
10 SASI_Hs01_00039824 predicted 797
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025270 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00070587 predicted 653
2 SASI_Rn01_00070594 predicted 610
3 SASI_Rn01_00070588 predicted 704
4 SASI_Rn01_00070589 predicted 379
5 SASI_Rn01_00070590 predicted 242
6 SASI_Rn01_00070591 predicted 445
7 SASI_Rn01_00070592 predicted 547
8 SASI_Rn02_00203083 predicted 363
9 SASI_Rn01_00070593 predicted 557
10 SASI_Rn01_00070596 predicted 242
11 SASI_Rn01_00070595 predicted 902
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008561 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00075391 predicted 1666
2 SASI_Mm01_00075392 predicted 1749
3 SASI_Mm01_00075393 predicted 972
4 SASI_Mm01_00075394 predicted 710
5 SASI_Mm01_00075396 predicted 646
6 SASI_Mm01_00075397 predicted 990
7 SASI_Mm01_00075398 predicted 720
8 SASI_Mm01_00075399 predicted 1674
9 SASI_Mm01_00075400 predicted 1510
10 SASI_Mm02_00314160 predicted 1749
11 SASI_Mm01_00075395 predicted 1304
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019888
MC3R MISSION shRNA Bacterial Glycerol Stock
melanocortin 3 receptor
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000368497    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019888.3-639s21c1
Sequence:CCGGGCGTGGTGTTCATCGTCTACTCTCGAGAGTAGACGATGAACACCACGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357551    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019888.3-430s21c1
Sequence:CCGGGACCTTCGAGGACCAGTTTATCTCGAGATAAACTGGTCCTCGAAGGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011756    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019888.2-807s1c1
Sequence:CCGGACAGCAACACTCATGCATGAACTCGAGTTCATGCATGAGTGTTGCTGTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357618    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019888.3-833s21c1
Sequence:CCGGGCAGTCACCATCACCATTCTCCTCGAGGAGAATGGTGATGGTGACTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011755    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019888.2-729s1c1
Sequence:CCGGCTACGTGCACATGTTCCTCTTCTCGAGAAGAGGAACATGTGCACGTAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011754    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019888.2-139s1c1
Sequence:CCGGGTTCAGCCAACACTGCCTAATCTCGAGATTAGGCAGTGTTGGCTGAACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011752    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019888.2-257s1c1
Sequence:CCGGGCATCGTCAGTCTGCTGGAAACTCGAGTTTCCAGCAGACTGACGATGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357549    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019888.3-225s21c1
Sequence:CCGGTCTTCATCAAGCCCGAGGTTTCTCGAGAAACCTCGGGCTTGATGAAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019888
MC3R MISSION shRNA shRNA Plasmid DNA
melanocortin 3 receptor
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000368497    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019888.3-639s21c1
Sequence:CCGGGCGTGGTGTTCATCGTCTACTCTCGAGAGTAGACGATGAACACCACGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000357551    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019888.3-430s21c1
Sequence:CCGGGACCTTCGAGGACCAGTTTATCTCGAGATAAACTGGTCCTCGAAGGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000011756    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019888.2-807s1c1
Sequence:CCGGACAGCAACACTCATGCATGAACTCGAGTTCATGCATGAGTGTTGCTGTTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000357618    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019888.3-833s21c1
Sequence:CCGGGCAGTCACCATCACCATTCTCCTCGAGGAGAATGGTGATGGTGACTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000011755    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019888.2-729s1c1
Sequence:CCGGCTACGTGCACATGTTCCTCTTCTCGAGAAGAGGAACATGTGCACGTAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000011754    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019888.2-139s1c1
Sequence:CCGGGTTCAGCCAACACTGCCTAATCTCGAGATTAGGCAGTGTTGGCTGAACTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000011752    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019888.2-257s1c1
Sequence:CCGGGCATCGTCAGTCTGCTGGAAACTCGAGTTTCCAGCAGACTGACGATGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000357549    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019888.3-225s21c1
Sequence:CCGGTCTTCATCAAGCCCGAGGTTTCTCGAGAAACCTCGGGCTTGATGAAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019888
MC3R MISSION shRNA Lentiviral Transduction Particles
melanocortin 3 receptor
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000368497    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019888.3-639s21c1
Sequence:CCGGGCGTGGTGTTCATCGTCTACTCTCGAGAGTAGACGATGAACACCACGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357551    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019888.3-430s21c1
Sequence:CCGGGACCTTCGAGGACCAGTTTATCTCGAGATAAACTGGTCCTCGAAGGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011756    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019888.2-807s1c1
Sequence:CCGGACAGCAACACTCATGCATGAACTCGAGTTCATGCATGAGTGTTGCTGTTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357618    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019888.3-833s21c1
Sequence:CCGGGCAGTCACCATCACCATTCTCCTCGAGGAGAATGGTGATGGTGACTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011755    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019888.2-729s1c1
Sequence:CCGGCTACGTGCACATGTTCCTCTTCTCGAGAAGAGGAACATGTGCACGTAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011754    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019888.2-139s1c1
Sequence:CCGGGTTCAGCCAACACTGCCTAATCTCGAGATTAGGCAGTGTTGGCTGAACTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011752    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019888.2-257s1c1
Sequence:CCGGGCATCGTCAGTCTGCTGGAAACTCGAGTTTCCAGCAGACTGACGATGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357549    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019888.3-225s21c1
Sequence:CCGGTCTTCATCAAGCCCGAGGTTTCTCGAGAAACCTCGGGCTTGATGAAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008561
MC3R MISSION shRNA Bacterial Glycerol Stock
melanocortin 3 receptor
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000026387    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008561.2-1288s1c1
Sequence:CCGGCGCAACACGTTCAAGGAGATTCTCGAGAATCTCCTTGAACGTGTTGCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026377    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008561.2-981s1c1
Sequence:CCGGCACCCTATATATCCACATGTTCTCGAGAACATGTGGATATATAGGGTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026367    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008561.2-726s1c1
Sequence:CCGGCTTCGACTCTATGATTTGCATCTCGAGATGCAAATCATAGAGTCGAAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026382    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008561.2-515s1c1
Sequence:CCGGGCATCGTCAGTCTGATGGAAACTCGAGTTTCCATCAGACTGACGATGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026390    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008561.2-1314s1c1
Sequence:CCGGCGGCTGCAACAGCATGAACTTCTCGAGAAGTTCATGCTGTTGCAGCCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008561
MC3R MISSION shRNA shRNA Plasmid DNA
melanocortin 3 receptor
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000026387    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008561.2-1288s1c1
Sequence:CCGGCGCAACACGTTCAAGGAGATTCTCGAGAATCTCCTTGAACGTGTTGCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000026377    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008561.2-981s1c1
Sequence:CCGGCACCCTATATATCCACATGTTCTCGAGAACATGTGGATATATAGGGTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000026367    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008561.2-726s1c1
Sequence:CCGGCTTCGACTCTATGATTTGCATCTCGAGATGCAAATCATAGAGTCGAAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000026382    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008561.2-515s1c1
Sequence:CCGGGCATCGTCAGTCTGATGGAAACTCGAGTTTCCATCAGACTGACGATGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000026390    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008561.2-1314s1c1
Sequence:CCGGCGGCTGCAACAGCATGAACTTCTCGAGAAGTTCATGCTGTTGCAGCCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008561
MC3R MISSION shRNA Lentiviral Transduction Particles
melanocortin 3 receptor
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000026387    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008561.2-1288s1c1
Sequence:CCGGCGCAACACGTTCAAGGAGATTCTCGAGAATCTCCTTGAACGTGTTGCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026377    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008561.2-981s1c1
Sequence:CCGGCACCCTATATATCCACATGTTCTCGAGAACATGTGGATATATAGGGTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026367    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008561.2-726s1c1
Sequence:CCGGCTTCGACTCTATGATTTGCATCTCGAGATGCAAATCATAGAGTCGAAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026382    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008561.2-515s1c1
Sequence:CCGGGCATCGTCAGTCTGATGGAAACTCGAGTTTCCATCAGACTGACGATGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026390    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008561.2-1314s1c1
Sequence:CCGGCGGCTGCAACAGCATGAACTTCTCGAGAAGTTCATGCTGTTGCAGCCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)