EMAIL THIS PAGE TO A FRIEND

MC5R

melanocortin 5 receptor

58 Gene Product Result for
Synonyms: MC2
UniProtKB ID: P33032, B0YJ34, Q502V1
Gene ID:
Human(4161) Summary: This gene encodes a member of the seven-pass transmembrane G protein-coupled melanocortin receptor protein family that stimulate cAMP signal transduction. The encoded protein is a receptor for melanocyte-stimulating hormone and adrenocorticotropic hormone and is suggested to play a role in sebum generation. [provided by RefSeq, Jun 2010]
Mouse(17203) melanocortin 5 receptor
Rat(25726) melanocortin 5 receptor
chicken(421047) melanocortin 5 receptor
domestic cat(101093399) melanocortin 5 receptor
cow(507987) melanocortin 5 receptor
dog(483981) melanocortin 5 receptor
sheep(780501) melanocortin receptor 5
naked mole-rat(101699585) melanocortin 5 receptor
domestic guinea pig(100730986) melanocortin 5 receptor
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_013596 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_013596 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_013596 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_005913 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005913 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005913 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU025611 MISSION® esiRNA esiRNA targeting mouse Mc5r (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005913 Rosetta Predictions human pricing
NM_013182 Rosetta Predictions rat pricing
NM_013596 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005913 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00141578 predicted 314
2 SASI_Hs01_00141579 predicted 345
3 SASI_Hs01_00141580 predicted 389
4 SASI_Hs01_00141581 predicted 542
5 SASI_Hs01_00141582 predicted 395
6 SASI_Hs02_00340534 predicted 322
7 SASI_Hs01_00141583 predicted 716
8 SASI_Hs01_00141584 predicted 328
9 SASI_Hs01_00141586 predicted 301
10 SASI_Hs02_00340535 predicted 714
11 SASI_Hs01_00141585 predicted 283
12 SASI_Hs01_00141587 predicted 237
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013182 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00261012 predicted 554
2 SASI_Rn01_00085760 predicted 672
3 SASI_Rn01_00085761 predicted 380
4 SASI_Rn01_00085762 predicted 586
5 SASI_Rn01_00085763 predicted 360
6 SASI_Rn02_00261013 predicted 513
7 SASI_Rn02_00261014 predicted 636
8 SASI_Rn01_00085766 predicted 311
9 SASI_Rn02_00261015 predicted 285
10 SASI_Rn02_00261016 predicted 644
11 SASI_Rn01_00085764 predicted 1154
12 SASI_Rn01_00085765 predicted 390
13 SASI_Rn01_00085767 predicted 1350
14 SASI_Rn01_00085768 predicted 1082
15 SASI_Rn01_00085769 predicted 257
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013596 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00064898 predicted 796
2 SASI_Mm01_00064899 predicted 669
3 SASI_Mm01_00064900 predicted 268
4 SASI_Mm01_00064901 predicted 505
5 SASI_Mm01_00064903 predicted 703
6 SASI_Mm01_00064904 predicted 443
7 SASI_Mm02_00322340 predicted 269
8 SASI_Mm02_00322341 predicted 301
9 SASI_Mm02_00322342 predicted 830
10 SASI_Mm02_00322343 predicted 717
11 SASI_Mm01_00064902 predicted 666
12 SASI_Mm01_00064905 predicted 921
13 SASI_Mm01_00064906 predicted 425
14 SASI_Mm01_00064907 predicted 479
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013596
MC5R MISSION shRNA Bacterial Glycerol Stock
melanocortin 5 receptor
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000026412    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013596.1-1003s1c1
Sequence:CCGGCATGTACCTTATACTCATCATCTCGAGATGATGAGTATAAGGTACATGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026356    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013596.1-449s1c1
Sequence:CCGGGTCACCATATACTTGCTAAATCTCGAGATTTAGCAAGTATATGGTGACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026338    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013596.1-263s1c1
Sequence:CCGGGCCTGTGAAGAAATGGGCATTCTCGAGAATGCCCATTTCTTCACAGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026335    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013596.1-87s1c1
Sequence:CCGGGTGAAGAATCATGCTTACCTTCTCGAGAAGGTAAGCATGATTCTTCACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026362    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013596.1-806s1c1
Sequence:CCGGCGGAACCATGTCAAGCGGATACTCGAGTATCCGCTTGACATGGTTCCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013596
MC5R MISSION shRNA shRNA Plasmid DNA
melanocortin 5 receptor
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000026412    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013596.1-1003s1c1
Sequence:CCGGCATGTACCTTATACTCATCATCTCGAGATGATGAGTATAAGGTACATGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000026356    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013596.1-449s1c1
Sequence:CCGGGTCACCATATACTTGCTAAATCTCGAGATTTAGCAAGTATATGGTGACTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000026338    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013596.1-263s1c1
Sequence:CCGGGCCTGTGAAGAAATGGGCATTCTCGAGAATGCCCATTTCTTCACAGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000026335    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013596.1-87s1c1
Sequence:CCGGGTGAAGAATCATGCTTACCTTCTCGAGAAGGTAAGCATGATTCTTCACTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000026362    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013596.1-806s1c1
Sequence:CCGGCGGAACCATGTCAAGCGGATACTCGAGTATCCGCTTGACATGGTTCCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013596
MC5R MISSION shRNA Lentiviral Transduction Particles
melanocortin 5 receptor
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000026412    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013596.1-1003s1c1
Sequence:CCGGCATGTACCTTATACTCATCATCTCGAGATGATGAGTATAAGGTACATGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026356    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013596.1-449s1c1
Sequence:CCGGGTCACCATATACTTGCTAAATCTCGAGATTTAGCAAGTATATGGTGACTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026338    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013596.1-263s1c1
Sequence:CCGGGCCTGTGAAGAAATGGGCATTCTCGAGAATGCCCATTTCTTCACAGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026335    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013596.1-87s1c1
Sequence:CCGGGTGAAGAATCATGCTTACCTTCTCGAGAAGGTAAGCATGATTCTTCACTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026362    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013596.1-806s1c1
Sequence:CCGGCGGAACCATGTCAAGCGGATACTCGAGTATCCGCTTGACATGGTTCCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005913
MC5R MISSION shRNA Bacterial Glycerol Stock
melanocortin 5 receptor
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000011764    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005913.1-534s1c1
Sequence:CCGGCCTGTACTCAGAATCCACCTACTCGAGTAGGTGGATTCTGAGTACAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011765    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005913.1-819s1c1
Sequence:CCGGCATGTCTCACTTCAATATGTACTCGAGTACATATTGAAGTGAGACATGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011763    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005913.1-94s1c1
Sequence:CCGGCCATGTGAAGACATGGGCATTCTCGAGAATGCCCATGTCTTCACATGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011762    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005913.1-334s1c1
Sequence:CCGGCGCCACATTGACAATGTGTTTCTCGAGAAACACATTGTCAATGTGGCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357623    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005913.1-110s21c1
Sequence:CCGGGCATTGCTGTGGAGGTGTTTCCTCGAGGAAACACCTCCACAGCAATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357555    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005913.1-761s21c1
Sequence:CCGGTCTTCCTTCATCTCACTTTAACTCGAGTTAAAGTGAGATGAAGGAAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357624    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005913.1-329s21c1
Sequence:CCGGTTGTGCGCCACATTGACAATGCTCGAGCATTGTCAATGTGGCGCACAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005913
MC5R MISSION shRNA shRNA Plasmid DNA
melanocortin 5 receptor
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000011764    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005913.1-534s1c1
Sequence:CCGGCCTGTACTCAGAATCCACCTACTCGAGTAGGTGGATTCTGAGTACAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000011765    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005913.1-819s1c1
Sequence:CCGGCATGTCTCACTTCAATATGTACTCGAGTACATATTGAAGTGAGACATGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000011763    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005913.1-94s1c1
Sequence:CCGGCCATGTGAAGACATGGGCATTCTCGAGAATGCCCATGTCTTCACATGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000011762    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005913.1-334s1c1
Sequence:CCGGCGCCACATTGACAATGTGTTTCTCGAGAAACACATTGTCAATGTGGCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000357623    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005913.1-110s21c1
Sequence:CCGGGCATTGCTGTGGAGGTGTTTCCTCGAGGAAACACCTCCACAGCAATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000357555    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005913.1-761s21c1
Sequence:CCGGTCTTCCTTCATCTCACTTTAACTCGAGTTAAAGTGAGATGAAGGAAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000357624    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005913.1-329s21c1
Sequence:CCGGTTGTGCGCCACATTGACAATGCTCGAGCATTGTCAATGTGGCGCACAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005913
MC5R MISSION shRNA Lentiviral Transduction Particles
melanocortin 5 receptor
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000011764    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005913.1-534s1c1
Sequence:CCGGCCTGTACTCAGAATCCACCTACTCGAGTAGGTGGATTCTGAGTACAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011765    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005913.1-819s1c1
Sequence:CCGGCATGTCTCACTTCAATATGTACTCGAGTACATATTGAAGTGAGACATGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011763    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005913.1-94s1c1
Sequence:CCGGCCATGTGAAGACATGGGCATTCTCGAGAATGCCCATGTCTTCACATGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011762    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005913.1-334s1c1
Sequence:CCGGCGCCACATTGACAATGTGTTTCTCGAGAAACACATTGTCAATGTGGCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357623    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005913.1-110s21c1
Sequence:CCGGGCATTGCTGTGGAGGTGTTTCCTCGAGGAAACACCTCCACAGCAATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357555    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005913.1-761s21c1
Sequence:CCGGTCTTCCTTCATCTCACTTTAACTCGAGTTAAAGTGAGATGAAGGAAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357624    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005913.1-329s21c1
Sequence:CCGGTTGTGCGCCACATTGACAATGCTCGAGCATTGTCAATGTGGCGCACAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)