EMAIL THIS PAGE TO A FRIEND

MCAM

melanoma cell adhesion molecule

86 Gene Product Result for
Synonyms: CD146 MUC18
UniProtKB ID: P43121, O95812, Q59E86, Q6PHR3, Q6ZTR2
Gene ID:
Mouse(84004) melanoma cell adhesion molecule
Rat(78967) melanoma cell adhesion molecule
chicken(448832) melanoma cell adhesion molecule
dog(489368) melanoma cell adhesion molecule
Horse(100071414) melanoma cell adhesion molecule
cow(281301) melanoma cell adhesion molecule
domestic cat(101096758) melanoma cell adhesion molecule
sheep(101115652) melanoma cell adhesion molecule
domestic guinea pig(100718224) melanoma cell adhesion molecule
naked mole-rat(101710370) melanoma cell adhesion molecule
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

ELISA

Product # Description Species Add to Cart
 
RAB1575 Human MCAM ELISA for serum, plasma and cell culture supernatants human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_023061 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_023061 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_023061 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_006500 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006500 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006500 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006500 Rosetta Predictions human pricing
NM_001034009 Rosetta Predictions rat pricing
NM_023983 Rosetta Predictions rat pricing
NM_023061 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006500 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00160142 predicted 1762
2 SASI_Hs01_00160143 predicted 1829
3 SASI_Hs01_00160144 predicted 1015
4 SASI_Hs01_00160145 predicted 1035
5 SASI_Hs01_00160146 predicted 1933
6 SASI_Hs01_00160147 predicted 1048
7 SASI_Hs01_00160148 predicted 1841
8 SASI_Hs01_00160149 predicted 319
9 SASI_Hs02_00341707 predicted 1842
10 SASI_Hs01_00160150 predicted 1713
11 SASI_Hs01_00160151 predicted 578
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001034009 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00203887 predicted 906
2 SASI_Rn01_00032881 predicted 1042
3 SASI_Rn01_00032882 predicted 312
4 SASI_Rn01_00032883 predicted 663
5 SASI_Rn01_00032884 predicted 1553
6 SASI_Rn01_00032885 predicted 481
7 SASI_Rn01_00032886 predicted 583
8 SASI_Rn01_00032888 predicted 1126
9 SASI_Rn01_00032889 predicted 533
10 SASI_Rn01_00032890 predicted 1358
11 SASI_Rn01_00032887 predicted 1079
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_023983 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00263807 predicted 905
2 SASI_Rn01_00033172 predicted 1039
3 SASI_Rn01_00033173 predicted 310
4 SASI_Rn01_00033174 predicted 666
5 SASI_Rn01_00033175 predicted 1554
6 SASI_Rn01_00033176 predicted 478
7 SASI_Rn01_00033177 predicted 586
8 SASI_Rn01_00033179 predicted 1129
9 SASI_Rn01_00033180 predicted 534
10 SASI_Rn01_00033181 predicted 1358
11 SASI_Rn01_00033178 predicted 1085
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_023061 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00136026 predicted 1721
2 SASI_Mm01_00136027 predicted 1059
3 SASI_Mm01_00136029 predicted 1269
4 SASI_Mm01_00136030 predicted 1843
5 SASI_Mm01_00136031 predicted 461
6 SASI_Mm01_00136032 predicted 543
7 SASI_Mm01_00136033 predicted 475
8 SASI_Mm01_00136034 predicted 838
9 SASI_Mm01_00136035 predicted 1094
10 SASI_Mm02_00326770 predicted 1428
11 SASI_Mm01_00136028 predicted 1763
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_023061
VALIDATED
MCAM MISSION shRNA Bacterial Glycerol Stock
melanoma cell adhesion molecule
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000376813    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023061.2-1843s21c1
Sequence:CCGGCGACTCGTAAGAGTGAATTTGCTCGAGCAAATTCACTCTTACGAGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366798    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_023061.2-2424s21c1
Sequence:CCGGTACTAATTCAGGGTCTCATTTCTCGAGAAATGAGACCCTGAATTAGTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366859    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023061.2-282s21c1
Sequence:CCGGCAGCGGGAACCTGGTGAATATCTCGAGATATTCACCAGGTTCCCGCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000375683    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_023061.2-2169s21c1
Sequence:CCGGCCTCCTCTGTGTCCAGTAAATCTCGAGATTTACTGGACACAGAGGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000375737    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023061.2-1045s21c1
Sequence:CCGGTGGAGCTGCTGGTGAACTATGCTCGAGCATAGTTCACCAGCAGCTCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000375735    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023061.2-1959s21c1
Sequence:CCGGTACATCGATCTGAGGCATTAGCTCGAGCTAATGCCTCAGATCGATGTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113080    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_023061.1-2409s1c1
Sequence:CCGGGCTACTAATTCAGGGTCTCATCTCGAGATGAGACCCTGAATTAGTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113082    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023061.1-1829s1c1
Sequence:CCGGCCGACTCGTAAGAGTGAATTTCTCGAGAAATTCACTCTTACGAGTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113084    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023061.1-582s1c1
Sequence:CCGGACCGAGTTCATATCCAGTCATCTCGAGATGACTGGATATGAACTCGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113083    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023061.1-1124s1c1
Sequence:CCGGGCAGAAAGTAACCAGGACCTTCTCGAGAAGGTCCTGGTTACTTTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113081    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_023061.1-656s1c1
Sequence:CCGGCGCCTAGTTAAGGAAGACAAACTCGAGTTTGTCTTCCTTAACTAGGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_023061
VALIDATED
MCAM MISSION shRNA shRNA Plasmid DNA
melanoma cell adhesion molecule
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000376813    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023061.2-1843s21c1
Sequence:CCGGCGACTCGTAAGAGTGAATTTGCTCGAGCAAATTCACTCTTACGAGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000366798    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_023061.2-2424s21c1
Sequence:CCGGTACTAATTCAGGGTCTCATTTCTCGAGAAATGAGACCCTGAATTAGTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000366859    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023061.2-282s21c1
Sequence:CCGGCAGCGGGAACCTGGTGAATATCTCGAGATATTCACCAGGTTCCCGCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000375683    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_023061.2-2169s21c1
Sequence:CCGGCCTCCTCTGTGTCCAGTAAATCTCGAGATTTACTGGACACAGAGGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000375737    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023061.2-1045s21c1
Sequence:CCGGTGGAGCTGCTGGTGAACTATGCTCGAGCATAGTTCACCAGCAGCTCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000375735    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023061.2-1959s21c1
Sequence:CCGGTACATCGATCTGAGGCATTAGCTCGAGCTAATGCCTCAGATCGATGTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000113080    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_023061.1-2409s1c1
Sequence:CCGGGCTACTAATTCAGGGTCTCATCTCGAGATGAGACCCTGAATTAGTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000113082    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023061.1-1829s1c1
Sequence:CCGGCCGACTCGTAAGAGTGAATTTCTCGAGAAATTCACTCTTACGAGTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000113084    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023061.1-582s1c1
Sequence:CCGGACCGAGTTCATATCCAGTCATCTCGAGATGACTGGATATGAACTCGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000113083    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023061.1-1124s1c1
Sequence:CCGGGCAGAAAGTAACCAGGACCTTCTCGAGAAGGTCCTGGTTACTTTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000113081    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_023061.1-656s1c1
Sequence:CCGGCGCCTAGTTAAGGAAGACAAACTCGAGTTTGTCTTCCTTAACTAGGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_023061
VALIDATED
MCAM MISSION shRNA Lentiviral Transduction Particles
melanoma cell adhesion molecule
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000376813    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023061.2-1843s21c1
Sequence:CCGGCGACTCGTAAGAGTGAATTTGCTCGAGCAAATTCACTCTTACGAGTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366798    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_023061.2-2424s21c1
Sequence:CCGGTACTAATTCAGGGTCTCATTTCTCGAGAAATGAGACCCTGAATTAGTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366859    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023061.2-282s21c1
Sequence:CCGGCAGCGGGAACCTGGTGAATATCTCGAGATATTCACCAGGTTCCCGCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000375683    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_023061.2-2169s21c1
Sequence:CCGGCCTCCTCTGTGTCCAGTAAATCTCGAGATTTACTGGACACAGAGGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000375737    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023061.2-1045s21c1
Sequence:CCGGTGGAGCTGCTGGTGAACTATGCTCGAGCATAGTTCACCAGCAGCTCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000375735    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023061.2-1959s21c1
Sequence:CCGGTACATCGATCTGAGGCATTAGCTCGAGCTAATGCCTCAGATCGATGTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113080    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_023061.1-2409s1c1
Sequence:CCGGGCTACTAATTCAGGGTCTCATCTCGAGATGAGACCCTGAATTAGTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113082    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023061.1-1829s1c1
Sequence:CCGGCCGACTCGTAAGAGTGAATTTCTCGAGAAATTCACTCTTACGAGTCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113084    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023061.1-582s1c1
Sequence:CCGGACCGAGTTCATATCCAGTCATCTCGAGATGACTGGATATGAACTCGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113083    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023061.1-1124s1c1
Sequence:CCGGGCAGAAAGTAACCAGGACCTTCTCGAGAAGGTCCTGGTTACTTTCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113081    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_023061.1-656s1c1
Sequence:CCGGCGCCTAGTTAAGGAAGACAAACTCGAGTTTGTCTTCCTTAACTAGGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006500
VALIDATED
MCAM MISSION shRNA Bacterial Glycerol Stock
melanoma cell adhesion molecule
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000281976    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006500.2-1325s21c1
Sequence:CCGGGATGGCATTCAAGGAGAGGAACTCGAGTTCCTCTCCTTGAATGCCATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275794    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006500.2-1856s21c1
Sequence:CCGGAGTTGAAGTTAAGTCAGATAACTCGAGTTATCTGACTTAACTTCAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275793    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006500.2-1566s21c1
Sequence:CCGGTTCCTGGAGCTGGTCAATTTACTCGAGTAAATTGACCAGCTCCAGGAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275792    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006500.2-2270s21c1
Sequence:CCGGCACACATTATGGCTGTAAATACTCGAGTATTTACAGCCATAATGTGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275791    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006500.2-1036s21c1
Sequence:CCGGAGGAACTACTGGTGAACTATGCTCGAGCATAGTTCACCAGTAGTTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156020    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006500.1-2406s1c1
Sequence:CCGGCTCATGTTGAAGTGCGCTGTTCTCGAGAACAGCGCACTTCAACATGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151337    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_006500.1-1365s1c1
Sequence:CCGGGTGTTGAATCTGTCTTGTGAACTCGAGTTCACAAGACAGATTCAACACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152241    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006500.1-657s1c1
Sequence:CCGGCAGCTGGTTAAAGAAGACAAACTCGAGTTTGTCTTCTTTAACCAGCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154854    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_006500.1-1322s1c1
Sequence:CCGGGATGGCATTCAAGGAGAGGAACTCGAGTTCCTCTCCTTGAATGCCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155692    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006500.1-529s1c1
Sequence:CCGGCCATTCCTCAAGTCATCTGGTCTCGAGACCAGATGACTTGAGGAATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006500
VALIDATED
MCAM MISSION shRNA shRNA Plasmid DNA
melanoma cell adhesion molecule
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000281976    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006500.2-1325s21c1
Sequence:CCGGGATGGCATTCAAGGAGAGGAACTCGAGTTCCTCTCCTTGAATGCCATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000275794    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006500.2-1856s21c1
Sequence:CCGGAGTTGAAGTTAAGTCAGATAACTCGAGTTATCTGACTTAACTTCAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000275793    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006500.2-1566s21c1
Sequence:CCGGTTCCTGGAGCTGGTCAATTTACTCGAGTAAATTGACCAGCTCCAGGAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000275792    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006500.2-2270s21c1
Sequence:CCGGCACACATTATGGCTGTAAATACTCGAGTATTTACAGCCATAATGTGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000275791    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006500.2-1036s21c1
Sequence:CCGGAGGAACTACTGGTGAACTATGCTCGAGCATAGTTCACCAGTAGTTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000156020    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006500.1-2406s1c1
Sequence:CCGGCTCATGTTGAAGTGCGCTGTTCTCGAGAACAGCGCACTTCAACATGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000151337    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_006500.1-1365s1c1
Sequence:CCGGGTGTTGAATCTGTCTTGTGAACTCGAGTTCACAAGACAGATTCAACACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000152241    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006500.1-657s1c1
Sequence:CCGGCAGCTGGTTAAAGAAGACAAACTCGAGTTTGTCTTCTTTAACCAGCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000154854    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_006500.1-1322s1c1
Sequence:CCGGGATGGCATTCAAGGAGAGGAACTCGAGTTCCTCTCCTTGAATGCCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000155692    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006500.1-529s1c1
Sequence:CCGGCCATTCCTCAAGTCATCTGGTCTCGAGACCAGATGACTTGAGGAATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006500
VALIDATED
MCAM MISSION shRNA Lentiviral Transduction Particles
melanoma cell adhesion molecule
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000281976    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006500.2-1325s21c1
Sequence:CCGGGATGGCATTCAAGGAGAGGAACTCGAGTTCCTCTCCTTGAATGCCATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275794    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006500.2-1856s21c1
Sequence:CCGGAGTTGAAGTTAAGTCAGATAACTCGAGTTATCTGACTTAACTTCAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275793    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006500.2-1566s21c1
Sequence:CCGGTTCCTGGAGCTGGTCAATTTACTCGAGTAAATTGACCAGCTCCAGGAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275792    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006500.2-2270s21c1
Sequence:CCGGCACACATTATGGCTGTAAATACTCGAGTATTTACAGCCATAATGTGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275791    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006500.2-1036s21c1
Sequence:CCGGAGGAACTACTGGTGAACTATGCTCGAGCATAGTTCACCAGTAGTTCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156020    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006500.1-2406s1c1
Sequence:CCGGCTCATGTTGAAGTGCGCTGTTCTCGAGAACAGCGCACTTCAACATGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151337    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_006500.1-1365s1c1
Sequence:CCGGGTGTTGAATCTGTCTTGTGAACTCGAGTTCACAAGACAGATTCAACACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152241    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006500.1-657s1c1
Sequence:CCGGCAGCTGGTTAAAGAAGACAAACTCGAGTTTGTCTTCTTTAACCAGCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154854    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_006500.1-1322s1c1
Sequence:CCGGGATGGCATTCAAGGAGAGGAACTCGAGTTCCTCTCCTTGAATGCCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155692    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006500.1-529s1c1
Sequence:CCGGCCATTCCTCAAGTCATCTGGTCTCGAGACCAGATGACTTGAGGAATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)