EMAIL THIS PAGE TO A FRIEND

MCAT

malonyl CoA:ACP acyltransferase (mitochondrial)

111 Gene Product Result for
Synonyms: FASN2C MCT MT NET62 fabD
UniProtKB ID: Q8IVS2, O95510, O95511
Gene ID:
Human(27349) Summary: The protein encoded by this gene is found exclusively in the mitochondrion, where it catalyzes the transfer of a malonyl group from malonyl-CoA to the mitochondrial acyl carrier protein. The encoded protein may be part of a fatty acid synthase complex that is more like the type II prokaryotic and plastid complexes rather than the type I human cytosolic complex. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Mar 2012]
Mouse(223722) malonyl CoA:ACP acyltransferase (mitochondrial)
Rat(315173) malonyl CoA:ACP acyltransferase (mitochondrial)
Zebrafish(564111) malonyl CoA:ACP acyltransferase (mitochondrial)
cow(508130) malonyl CoA:ACP acyltransferase (mitochondrial)
domestic cat(101092125) malonyl CoA:ACP acyltransferase (mitochondrial)
dog(609532) malonyl CoA:ACP acyltransferase (mitochondrial)
chicken(427934) malonyl CoA:ACP acyltransferase (mitochondrial)
domestic guinea pig(100725844) malonyl CoA:ACP acyltransferase (mitochondrial)
naked mole-rat(101714483) malonyl CoA:ACP acyltransferase (mitochondrial)
sheep(101116642) malonyl CoA:ACP acyltransferase (mitochondrial)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001030014 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001030014 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001030014 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_173467 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_173467 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_173467 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014507 Rosetta Predictions human pricing
NM_173467 Rosetta Predictions human pricing
XM_001077904 Rosetta Predictions rat pricing
XM_235527 Rosetta Predictions rat pricing
NM_001030014 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014507 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00137769 predicted 815
2 SASI_Hs02_00345766 predicted 1039
3 SASI_Hs02_00345767 predicted 928
4 SASI_Hs02_00345768 predicted 812
5 SASI_Hs02_00345769 predicted 895
6 SASI_Hs02_00345770 predicted 620
7 SASI_Hs02_00345771 predicted 560
8 SASI_Hs02_00345772 predicted 581
9 SASI_Hs02_00345773 predicted 673
10 SASI_Hs02_00345774 predicted 505
11 SASI_Hs01_00137764 predicted 274
12 SASI_Hs01_00137765 predicted 803
13 SASI_Hs01_00137766 predicted 297
14 SASI_Hs01_00137767 predicted 213
15 SASI_Hs01_00137768 predicted 300
16 SASI_Hs01_00137770 predicted 216
17 SASI_Hs01_00137771 predicted 302
18 SASI_Hs01_00137772 predicted 899
19 SASI_Hs01_00137773 predicted 809
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173467 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00368206 predicted 1649
2 SASI_Hs02_00368207 predicted 1683
3 SASI_Hs02_00368208 predicted 1033
4 SASI_Hs02_00368209 predicted 1685
5 SASI_Hs01_00231056 predicted 1034
6 SASI_Hs02_00368210 predicted 1422
7 SASI_Hs02_00368211 predicted 1660
8 SASI_Hs02_00368212 predicted 1254
9 SASI_Hs01_00231060 predicted 1034
10 SASI_Hs02_00368213 predicted 1142
11 SASI_Hs01_00231051 predicted 270
12 SASI_Hs01_00231052 predicted 1021
13 SASI_Hs01_00231053 predicted 297
14 SASI_Hs01_00231054 predicted 209
15 SASI_Hs01_00231055 predicted 293
16 SASI_Hs01_00231057 predicted 218
17 SASI_Hs01_00231058 predicted 293
18 SASI_Hs01_00231059 predicted 1125
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001077904 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00358958 predicted 427
2 SASI_Rn02_00358959 predicted 736
3 SASI_Rn02_00358960 predicted 422
4 SASI_Rn02_00358961 predicted 886
5 SASI_Rn02_00358962 predicted 448
6 SASI_Rn02_00358963 predicted 566
7 SASI_Rn02_00358964 predicted 704
8 SASI_Rn02_00358965 predicted 410
9 SASI_Rn02_00358966 predicted 519
10 SASI_Rn02_00358967 predicted 732
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_235527 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00389429 predicted 418
2 SASI_Rn02_00389430 predicted 734
3 SASI_Rn02_00389431 predicted 425
4 SASI_Rn02_00389432 predicted 884
5 SASI_Rn02_00389433 predicted 454
6 SASI_Rn02_00389434 predicted 564
7 SASI_Rn02_00389435 predicted 709
8 SASI_Rn02_00389436 predicted 405
9 SASI_Rn02_00389437 predicted 516
10 SASI_Rn02_00389438 predicted 734
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001030014 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00100118 predicted 863
2 SASI_Mm01_00100119 predicted 757
3 SASI_Mm01_00100120 predicted 1620
4 SASI_Mm01_00100121 predicted 1520
5 SASI_Mm01_00100122 predicted 1275
6 SASI_Mm01_00100123 predicted 1435
7 SASI_Mm01_00100125 predicted 1006
8 SASI_Mm01_00100126 predicted 1387
9 SASI_Mm01_00100127 predicted 1283
10 SASI_Mm02_00288120 predicted 807
11 SASI_Mm01_00100124 predicted 1587
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001030014
VALIDATED
MCAT MISSION shRNA Bacterial Glycerol Stock
malonyl CoA:ACP acyltransferase (mitochondrial)
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000201558    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001030014.1-857s1c1
Sequence:CCGGCCCTGATGAAAGTTCTAGGCTCTCGAGAGCCTAGAACTTTCATCAGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000201439    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001030014.1-1128s1c1
Sequence:CCGGCCATGTGGATGTGATGCAGAACTCGAGTTCTGCATCACATCCACATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192785    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001030014.1-1281s1c1
Sequence:CCGGGCATAGTCTTTGAGTGCCTATCTCGAGATAGGCACTCAAAGACTATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191075    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001030014.1-1526s1c1
Sequence:CCGGCCTTTGGTCTTGAATCTTGAACTCGAGTTCAAGATTCAAGACCAAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190311    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001030014.1-554s1c1
Sequence:CCGGCCGAAGCTATGCAAGAAGCATCTCGAGATGCTTCTTGCATAGCTTCGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000297687    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001030014.2-554s21c1
Sequence:CCGGCCGAAGCTATGCAAGAAGCATCTCGAGATGCTTCTTGCATAGCTTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000279541    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001030014.2-857s21c1
Sequence:CCGGCCCTGATGAAAGTTCTAGGCTCTCGAGAGCCTAGAACTTTCATCAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000297689    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001030014.2-1128s21c1
Sequence:CCGGCCATGTGGATGTGATGCAGAACTCGAGTTCTGCATCACATCCACATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000279540    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001030014.2-1526s21c1
Sequence:CCGGCCTTTGGTCTTGAATCTTGAACTCGAGTTCAAGATTCAAGACCAAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001030014
VALIDATED
MCAT MISSION shRNA shRNA Plasmid DNA
malonyl CoA:ACP acyltransferase (mitochondrial)
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000201558    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001030014.1-857s1c1
Sequence:CCGGCCCTGATGAAAGTTCTAGGCTCTCGAGAGCCTAGAACTTTCATCAGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000201439    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001030014.1-1128s1c1
Sequence:CCGGCCATGTGGATGTGATGCAGAACTCGAGTTCTGCATCACATCCACATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000192785    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001030014.1-1281s1c1
Sequence:CCGGGCATAGTCTTTGAGTGCCTATCTCGAGATAGGCACTCAAAGACTATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000191075    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001030014.1-1526s1c1
Sequence:CCGGCCTTTGGTCTTGAATCTTGAACTCGAGTTCAAGATTCAAGACCAAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000190311    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001030014.1-554s1c1
Sequence:CCGGCCGAAGCTATGCAAGAAGCATCTCGAGATGCTTCTTGCATAGCTTCGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000297687    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001030014.2-554s21c1
Sequence:CCGGCCGAAGCTATGCAAGAAGCATCTCGAGATGCTTCTTGCATAGCTTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000279541    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001030014.2-857s21c1
Sequence:CCGGCCCTGATGAAAGTTCTAGGCTCTCGAGAGCCTAGAACTTTCATCAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000297689    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001030014.2-1128s21c1
Sequence:CCGGCCATGTGGATGTGATGCAGAACTCGAGTTCTGCATCACATCCACATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000279540    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001030014.2-1526s21c1
Sequence:CCGGCCTTTGGTCTTGAATCTTGAACTCGAGTTCAAGATTCAAGACCAAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001030014
VALIDATED
MCAT MISSION shRNA Lentiviral Transduction Particles
malonyl CoA:ACP acyltransferase (mitochondrial)
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000201558    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001030014.1-857s1c1
Sequence:CCGGCCCTGATGAAAGTTCTAGGCTCTCGAGAGCCTAGAACTTTCATCAGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000201439    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001030014.1-1128s1c1
Sequence:CCGGCCATGTGGATGTGATGCAGAACTCGAGTTCTGCATCACATCCACATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192785    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001030014.1-1281s1c1
Sequence:CCGGGCATAGTCTTTGAGTGCCTATCTCGAGATAGGCACTCAAAGACTATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191075    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001030014.1-1526s1c1
Sequence:CCGGCCTTTGGTCTTGAATCTTGAACTCGAGTTCAAGATTCAAGACCAAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190311    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001030014.1-554s1c1
Sequence:CCGGCCGAAGCTATGCAAGAAGCATCTCGAGATGCTTCTTGCATAGCTTCGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000297687    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001030014.2-554s21c1
Sequence:CCGGCCGAAGCTATGCAAGAAGCATCTCGAGATGCTTCTTGCATAGCTTCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000279541    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001030014.2-857s21c1
Sequence:CCGGCCCTGATGAAAGTTCTAGGCTCTCGAGAGCCTAGAACTTTCATCAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000297689    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001030014.2-1128s21c1
Sequence:CCGGCCATGTGGATGTGATGCAGAACTCGAGTTCTGCATCACATCCACATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000279540    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001030014.2-1526s21c1
Sequence:CCGGCCTTTGGTCTTGAATCTTGAACTCGAGTTCAAGATTCAAGACCAAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_173467
VALIDATED
MCAT MISSION shRNA Bacterial Glycerol Stock
malonyl CoA:ACP acyltransferase (mitochondrial)
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000164583    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173467.2-647s1c1
Sequence:CCGGCCAAGTTCAACTTCGCCTGTTCTCGAGAACAGGCGAAGTTGAACTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162571    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173467.2-1110s1c1
Sequence:CCGGCATCCTGAAGAGCTGTAACATCTCGAGATGTTACAGCTCTTCAGGATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162823    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173467.2-676s1c1
Sequence:CCGGCGGGAACACTGCAAGTCTTTACTCGAGTAAAGACTTGCAGTGTTCCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160580    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173467.2-687s1c1
Sequence:CCGGCAAGTCTTTAGGCATAGAGAACTCGAGTTCTCTATGCCTAAAGACTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163319    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A3
TRC Version: 1.5 Clone ID:NM_173467.2-1023s1c1
Sequence:CCGGGCAGACGATGCATGCCATATACTCGAGTATATGGCATGCATCGTCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160966    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173467.2-466s1c1
Sequence:CCGGGTGATTGAGAACTGTGTTGCTCTCGAGAGCAACACAGTTCTCAATCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163245    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173467.2-901s1c1
Sequence:CCGGGCAGTCGACATTAAGAAGCCTCTCGAGAGGCTTCTTAATGTCGACTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236296    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173467.4-745s21c1
Sequence:CCGGTCCAGATTGCAGGGTGATTTCCTCGAGGAAATCACCCTGCAATCTGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236295    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173467.4-901s21c1
Sequence:CCGGTTTAAAGGCAGTCGACATTAACTCGAGTTAATGTCGACTGCCTTTAAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236292    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173467.4-1031s21c1
Sequence:CCGGCAGACGATGCATGCCATATACCTCGAGGTATATGGCATGCATCGTCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236294    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173467.4-1347s21c1
Sequence:CCGGGTGCTTTGAAGGCCACATAAACTCGAGTTTATGTGGCCTTCAAAGCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236293    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173467.4-533s21c1
Sequence:CCGGTTTGCCGGAGCCATGGAATTTCTCGAGAAATTCCATGGCTCCGGCAAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_173467
VALIDATED
MCAT MISSION shRNA shRNA Plasmid DNA
malonyl CoA:ACP acyltransferase (mitochondrial)
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000164583    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173467.2-647s1c1
Sequence:CCGGCCAAGTTCAACTTCGCCTGTTCTCGAGAACAGGCGAAGTTGAACTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000162571    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173467.2-1110s1c1
Sequence:CCGGCATCCTGAAGAGCTGTAACATCTCGAGATGTTACAGCTCTTCAGGATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000162823    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173467.2-676s1c1
Sequence:CCGGCGGGAACACTGCAAGTCTTTACTCGAGTAAAGACTTGCAGTGTTCCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000160580    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173467.2-687s1c1
Sequence:CCGGCAAGTCTTTAGGCATAGAGAACTCGAGTTCTCTATGCCTAAAGACTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000163319    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A3
TRC Version: 1.5 Clone ID:NM_173467.2-1023s1c1
Sequence:CCGGGCAGACGATGCATGCCATATACTCGAGTATATGGCATGCATCGTCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000160966    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173467.2-466s1c1
Sequence:CCGGGTGATTGAGAACTGTGTTGCTCTCGAGAGCAACACAGTTCTCAATCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000163245    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173467.2-901s1c1
Sequence:CCGGGCAGTCGACATTAAGAAGCCTCTCGAGAGGCTTCTTAATGTCGACTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000236296    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173467.4-745s21c1
Sequence:CCGGTCCAGATTGCAGGGTGATTTCCTCGAGGAAATCACCCTGCAATCTGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000236295    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173467.4-901s21c1
Sequence:CCGGTTTAAAGGCAGTCGACATTAACTCGAGTTAATGTCGACTGCCTTTAAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000236292    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173467.4-1031s21c1
Sequence:CCGGCAGACGATGCATGCCATATACCTCGAGGTATATGGCATGCATCGTCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000236294    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173467.4-1347s21c1
Sequence:CCGGGTGCTTTGAAGGCCACATAAACTCGAGTTTATGTGGCCTTCAAAGCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000236293    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173467.4-533s21c1
Sequence:CCGGTTTGCCGGAGCCATGGAATTTCTCGAGAAATTCCATGGCTCCGGCAAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_173467
VALIDATED
MCAT MISSION shRNA Lentiviral Transduction Particles
malonyl CoA:ACP acyltransferase (mitochondrial)
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000164583    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173467.2-647s1c1
Sequence:CCGGCCAAGTTCAACTTCGCCTGTTCTCGAGAACAGGCGAAGTTGAACTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162571    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173467.2-1110s1c1
Sequence:CCGGCATCCTGAAGAGCTGTAACATCTCGAGATGTTACAGCTCTTCAGGATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162823    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173467.2-676s1c1
Sequence:CCGGCGGGAACACTGCAAGTCTTTACTCGAGTAAAGACTTGCAGTGTTCCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160580    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173467.2-687s1c1
Sequence:CCGGCAAGTCTTTAGGCATAGAGAACTCGAGTTCTCTATGCCTAAAGACTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163319    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A3
TRC Version: 1.5 Clone ID:NM_173467.2-1023s1c1
Sequence:CCGGGCAGACGATGCATGCCATATACTCGAGTATATGGCATGCATCGTCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160966    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173467.2-466s1c1
Sequence:CCGGGTGATTGAGAACTGTGTTGCTCTCGAGAGCAACACAGTTCTCAATCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163245    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173467.2-901s1c1
Sequence:CCGGGCAGTCGACATTAAGAAGCCTCTCGAGAGGCTTCTTAATGTCGACTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236296    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173467.4-745s21c1
Sequence:CCGGTCCAGATTGCAGGGTGATTTCCTCGAGGAAATCACCCTGCAATCTGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236295    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173467.4-901s21c1
Sequence:CCGGTTTAAAGGCAGTCGACATTAACTCGAGTTAATGTCGACTGCCTTTAAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236292    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173467.4-1031s21c1
Sequence:CCGGCAGACGATGCATGCCATATACCTCGAGGTATATGGCATGCATCGTCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236294    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173467.4-1347s21c1
Sequence:CCGGGTGCTTTGAAGGCCACATAAACTCGAGTTTATGTGGCCTTCAAAGCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236293    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173467.4-533s21c1
Sequence:CCGGTTTGCCGGAGCCATGGAATTTCTCGAGAAATTCCATGGCTCCGGCAAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)