EMAIL THIS PAGE TO A FRIEND

MCC

mutated in colorectal cancers

93 Gene Product Result for
Synonyms: MCC1
UniProtKB ID: P23508, D3DT05, Q6ZR04
Gene ID:
Human(4163) Summary: This gene is a candidate colorectal tumor suppressor gene that is thought to negatively regulate cell cycle progression. The orthologous gene in the mouse expresses a phosphoprotein associated with the plasma membrane and membrane organelles, and overexpression of the mouse protein inhibits entry into S phase. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Mouse(328949) mutated in colorectal cancers
Rat(307449) mutated in colorectal cancers
sheep(101121522) mutated in colorectal cancers
naked mole-rat(101696544) mutated in colorectal cancers
domestic guinea pig(100733895) mutated in colorectal cancers
Zebrafish(100537329) mutated in colorectal cancers
domestic cat(101097788) mutated in colorectal cancers
cow(616704) mutated in colorectal cancers
Horse(100064404) mutated in colorectal cancers
dog(611208) mutated in colorectal cancers
chicken(415603) mutated in colorectal cancers
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002387 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002387 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002387 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001085373 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001085373 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001085373 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001085377 Rosetta Predictions human pricing
NM_002387 Rosetta Predictions human pricing
XM_001055717 Rosetta Predictions rat pricing
XM_225962 Rosetta Predictions rat pricing
NM_001033406 Rosetta Predictions mouse pricing
NM_001085373 Rosetta Predictions mouse pricing
NM_001085374 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001085377 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00317536 predicted 3454
2 SASI_Hs02_00317537 predicted 1761
3 SASI_Hs02_00317538 predicted 1419
4 SASI_Hs02_00317539 predicted 2028
5 SASI_Hs02_00317540 predicted 2177
6 SASI_Hs02_00317541 predicted 3256
7 SASI_Hs02_00317542 predicted 3417
8 SASI_Hs02_00317543 predicted 1942
9 SASI_Hs02_00317544 predicted 3054
10 SASI_Hs02_00317545 predicted 3175
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002387 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00241277 predicted 2995
2 SASI_Hs01_00241278 predicted 1309
3 SASI_Hs01_00241279 predicted 954
4 SASI_Hs01_00241280 predicted 1565
5 SASI_Hs01_00241281 predicted 1713
6 SASI_Hs02_00333739 predicted 2796
7 SASI_Hs01_00241282 predicted 2954
8 SASI_Hs02_00333740 predicted 1483
9 SASI_Hs02_00333741 predicted 2593
10 SASI_Hs01_00241283 predicted 2721
11 SASI_Hs01_00241276 predicted 306
12 SASI_Hs01_00241284 predicted 980
13 SASI_Hs01_00241285 predicted 450
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001055717 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00280728 predicted 2106
2 SASI_Rn02_00280729 predicted 3372
3 SASI_Rn02_00280730 predicted 505
4 SASI_Rn02_00280731 predicted 1693
5 SASI_Rn02_00280732 predicted 1676
6 SASI_Rn02_00280733 predicted 2878
7 SASI_Rn02_00280734 predicted 632
8 SASI_Rn02_00280735 predicted 2095
9 SASI_Rn02_00280736 predicted 654
10 SASI_Rn02_00280737 predicted 1264
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_225962 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00383280 predicted 1741
2 SASI_Rn02_00383281 predicted 3003
3 SASI_Rn02_00383282 predicted 1328
4 SASI_Rn02_00383283 predicted 1316
5 SASI_Rn02_00383284 predicted 958
6 SASI_Rn02_00383285 predicted 2512
7 SASI_Rn02_00383286 predicted 1554
8 SASI_Rn02_00383287 predicted 265
9 SASI_Rn02_00383288 predicted 1731
10 SASI_Rn02_00383289 predicted 293
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033406 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00186708 predicted 520
2 SASI_Mm01_00186709 predicted 718
3 SASI_Mm01_00186710 predicted 614
4 SASI_Mm01_00186711 predicted 603
5 SASI_Mm01_00186712 predicted 566
6 SASI_Mm01_00186713 predicted 630
7 SASI_Mm01_00186714 predicted 841
8 SASI_Mm01_00186715 predicted 517
9 SASI_Mm01_00186716 predicted 536
10 SASI_Mm01_00186717 predicted 448
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001085373 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00300235 predicted 2234
2 SASI_Mm02_00300236 predicted 1752
3 SASI_Mm02_00300237 predicted 1184
4 SASI_Mm02_00300238 predicted 1730
5 SASI_Mm02_00300239 predicted 1741
6 SASI_Mm02_00300240 predicted 802
7 SASI_Mm02_00300241 predicted 1553
8 SASI_Mm02_00300242 predicted 1728
9 SASI_Mm02_00300243 predicted 3005
10 SASI_Mm02_00300244 predicted 2513
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001085374 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00300245 predicted 2203
2 SASI_Mm02_00300246 predicted 1720
3 SASI_Mm02_00300247 predicted 1152
4 SASI_Mm02_00300248 predicted 1699
5 SASI_Mm02_00300249 predicted 1707
6 SASI_Mm02_00300250 predicted 762
7 SASI_Mm02_00300251 predicted 1523
8 SASI_Mm02_00300252 predicted 1687
9 SASI_Mm02_00300253 predicted 2979
10 SASI_Mm02_00300254 predicted 2482
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002387
MCC MISSION shRNA Bacterial Glycerol Stock
mutated in colorectal cancers
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000431593    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002387.2-2199s21c1
Sequence:CCGGTGCGACACCGAGTTCACTAAACTCGAGTTTAGTGAACTCGGTGTCGCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422783    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002387.2-1512s21c1
Sequence:CCGGGAGAGGGTGAAGCTATCAAAGCTCGAGCTTTGATAGCTTCACCCTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429890    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002387.2-1290s21c1
Sequence:CCGGGAAGAACTGAACCGGACTAAGCTCGAGCTTAGTCCGGTTCAGTTCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422216    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002387.2-2807s21c1
Sequence:CCGGAGAGTTCGTGAATGATCTAAACTCGAGTTTAGATCATTCACGAACTCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000038165    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002387.1-1332s1c1
Sequence:CCGGGCTCCAATATCCAAGAGATTTCTCGAGAAATCTCTTGGATATTGGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000038168    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002387.1-2284s1c1
Sequence:CCGGCAGCAAAGATAAACCTGGCAACTCGAGTTGCCAGGTTTATCTTTGCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000038167    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002387.1-1388s1c1
Sequence:CCGGGAAAGCAAGATTAGAGAGTTTCTCGAGAAACTCTCTAATCTTGCTTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000038166    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002387.1-2689s1c1
Sequence:CCGGCACCAATGAAACTTCGCTTTACTCGAGTAAAGCGAAGTTTCATTGGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002387
MCC MISSION shRNA shRNA Plasmid DNA
mutated in colorectal cancers
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000431593    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002387.2-2199s21c1
Sequence:CCGGTGCGACACCGAGTTCACTAAACTCGAGTTTAGTGAACTCGGTGTCGCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000422783    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002387.2-1512s21c1
Sequence:CCGGGAGAGGGTGAAGCTATCAAAGCTCGAGCTTTGATAGCTTCACCCTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000429890    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002387.2-1290s21c1
Sequence:CCGGGAAGAACTGAACCGGACTAAGCTCGAGCTTAGTCCGGTTCAGTTCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000422216    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002387.2-2807s21c1
Sequence:CCGGAGAGTTCGTGAATGATCTAAACTCGAGTTTAGATCATTCACGAACTCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000038165    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002387.1-1332s1c1
Sequence:CCGGGCTCCAATATCCAAGAGATTTCTCGAGAAATCTCTTGGATATTGGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000038168    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002387.1-2284s1c1
Sequence:CCGGCAGCAAAGATAAACCTGGCAACTCGAGTTGCCAGGTTTATCTTTGCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000038167    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002387.1-1388s1c1
Sequence:CCGGGAAAGCAAGATTAGAGAGTTTCTCGAGAAACTCTCTAATCTTGCTTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000038166    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002387.1-2689s1c1
Sequence:CCGGCACCAATGAAACTTCGCTTTACTCGAGTAAAGCGAAGTTTCATTGGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002387
MCC MISSION shRNA Lentiviral Transduction Particles
mutated in colorectal cancers
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000431593    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002387.2-2199s21c1
Sequence:CCGGTGCGACACCGAGTTCACTAAACTCGAGTTTAGTGAACTCGGTGTCGCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422783    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002387.2-1512s21c1
Sequence:CCGGGAGAGGGTGAAGCTATCAAAGCTCGAGCTTTGATAGCTTCACCCTCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429890    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002387.2-1290s21c1
Sequence:CCGGGAAGAACTGAACCGGACTAAGCTCGAGCTTAGTCCGGTTCAGTTCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422216    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002387.2-2807s21c1
Sequence:CCGGAGAGTTCGTGAATGATCTAAACTCGAGTTTAGATCATTCACGAACTCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000038165    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002387.1-1332s1c1
Sequence:CCGGGCTCCAATATCCAAGAGATTTCTCGAGAAATCTCTTGGATATTGGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000038168    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002387.1-2284s1c1
Sequence:CCGGCAGCAAAGATAAACCTGGCAACTCGAGTTGCCAGGTTTATCTTTGCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000038167    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002387.1-1388s1c1
Sequence:CCGGGAAAGCAAGATTAGAGAGTTTCTCGAGAAACTCTCTAATCTTGCTTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000038166    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002387.1-2689s1c1
Sequence:CCGGCACCAATGAAACTTCGCTTTACTCGAGTAAAGCGAAGTTTCATTGGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001085373
VALIDATED
MCC MISSION shRNA Bacterial Glycerol Stock
mutated in colorectal cancers
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000251723    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001085373.1-899s21c1
Sequence:CCGGCAGAGTCAACAAGAGGTTAATCTCGAGATTAACCTCTTGTTGACTCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251722    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001085373.1-1745s21c1
Sequence:CCGGGAACGATTGAATAGTCGTATTCTCGAGAATACGACTATTCAATCGTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251721    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001085373.1-2241s21c1
Sequence:CCGGAGCAAAGGTTGAAGGATTATACTCGAGTATAATCCTTCAACCTTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251720    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085373.1-2656s21c1
Sequence:CCGGTTTGTCACTTGCCGAACTAAGCTCGAGCTTAGTTCGGCAAGTGACAAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000265240    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001085373.1-792s21c1
Sequence:CCGGCAGAACTCCACAGTATCATTGCTCGAGCAATGATACTGTGGAGTTCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001085373
VALIDATED
MCC MISSION shRNA shRNA Plasmid DNA
mutated in colorectal cancers
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000251723    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001085373.1-899s21c1
Sequence:CCGGCAGAGTCAACAAGAGGTTAATCTCGAGATTAACCTCTTGTTGACTCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000251722    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001085373.1-1745s21c1
Sequence:CCGGGAACGATTGAATAGTCGTATTCTCGAGAATACGACTATTCAATCGTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000251721    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001085373.1-2241s21c1
Sequence:CCGGAGCAAAGGTTGAAGGATTATACTCGAGTATAATCCTTCAACCTTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000251720    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085373.1-2656s21c1
Sequence:CCGGTTTGTCACTTGCCGAACTAAGCTCGAGCTTAGTTCGGCAAGTGACAAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000265240    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001085373.1-792s21c1
Sequence:CCGGCAGAACTCCACAGTATCATTGCTCGAGCAATGATACTGTGGAGTTCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001085373
VALIDATED
MCC MISSION shRNA Lentiviral Transduction Particles
mutated in colorectal cancers
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000251723    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001085373.1-899s21c1
Sequence:CCGGCAGAGTCAACAAGAGGTTAATCTCGAGATTAACCTCTTGTTGACTCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251722    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001085373.1-1745s21c1
Sequence:CCGGGAACGATTGAATAGTCGTATTCTCGAGAATACGACTATTCAATCGTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251721    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001085373.1-2241s21c1
Sequence:CCGGAGCAAAGGTTGAAGGATTATACTCGAGTATAATCCTTCAACCTTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251720    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085373.1-2656s21c1
Sequence:CCGGTTTGTCACTTGCCGAACTAAGCTCGAGCTTAGTTCGGCAAGTGACAAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000265240    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001085373.1-792s21c1
Sequence:CCGGCAGAACTCCACAGTATCATTGCTCGAGCAATGATACTGTGGAGTTCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)