EMAIL THIS PAGE TO A FRIEND

MCCC1

methylcrotonoyl-CoA carboxylase 1 (alpha)

64 Gene Product Result for
Synonyms: MCC-B MCCA
UniProtKB ID: Q96RQ3, Q59ES4, Q9H959, Q9NS97
Gene ID:
Human(56922) Summary: This gene encodes the large subunit of 3-methylcrotonyl-CoA carboxylase. This enzyme functions as a heterodimer and catalyzes the carboxylation of 3-methylcrotonyl-CoA to form 3-methylglutaconyl-CoA. Mutations in this gene are associated with 3-Methylcrotonylglycinuria, an autosomal recessive disorder of leucine catabolism. [provided by RefSeq, Jul 2008]
Mouse(72039) methylcrotonoyl-Coenzyme A carboxylase 1 (alpha)
Rat(294972) methylcrotonoyl-CoA carboxylase 1 (alpha)
Zebrafish(777632) methylcrotonoyl-Coenzyme A carboxylase 1 (alpha)
cow(513504) methylcrotonoyl-CoA carboxylase 1 (alpha)
Horse(100058574) methylcrotonoyl-CoA carboxylase 1 (alpha)
domestic cat(101096912) methylcrotonoyl-CoA carboxylase 1 (alpha)
dog(478645) methylcrotonoyl-CoA carboxylase 1 (alpha)
chicken(424962) methylcrotonoyl-CoA carboxylase 1 (alpha)
domestic guinea pig(100717591) methylcrotonoyl-CoA carboxylase 1 (alpha)
naked mole-rat(101704843) methylcrotonoyl-CoA carboxylase 1 (alpha)
Domestic Rabbit(100351520) methylcrotonoyl-CoA carboxylase 1 (alpha)
sheep(101110023) methylcrotonoyl-CoA carboxylase 1 (alpha)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_020166 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020166 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020166 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_023644 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_023644 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_023644 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020166 Rosetta Predictions human pricing
NM_001009653 Rosetta Predictions rat pricing
NM_023644 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020166 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00067139 predicted 302
2 SASI_Hs01_00067140 predicted 1834
3 SASI_Hs01_00067142 predicted 1619
4 SASI_Hs01_00067143 predicted 1328
5 SASI_Hs02_00353073 predicted 1090
6 SASI_Hs01_00067144 predicted 1937
7 SASI_Hs02_00353074 predicted 831
8 SASI_Hs01_00067145 predicted 815
9 SASI_Hs01_00067146 predicted 1807
10 SASI_Hs01_00067147 predicted 1603
11 SASI_Hs01_00067138 predicted 602
12 SASI_Hs01_00067141 predicted 2173
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001009653 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00038369 predicted 1657
2 SASI_Rn02_00199680 predicted 573
3 SASI_Rn01_00038370 predicted 1714
4 SASI_Rn01_00038371 predicted 253
5 SASI_Rn01_00038372 predicted 1141
6 SASI_Rn01_00038373 predicted 1802
7 SASI_Rn01_00038374 predicted 470
8 SASI_Rn01_00038375 predicted 479
9 SASI_Rn01_00038376 predicted 1703
10 SASI_Rn02_00199681 predicted 2043
11 SASI_Rn01_00038377 predicted 1634
12 SASI_Rn01_00038378 predicted 2125
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_023644 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00189196 predicted 1824
2 SASI_Mm02_00327256 predicted 1737
3 SASI_Mm01_00189197 predicted 803
4 SASI_Mm01_00189198 predicted 1802
5 SASI_Mm01_00189205 predicted 1161
6 SASI_Mm01_00189200 predicted 1792
7 SASI_Mm01_00189201 predicted 823
8 SASI_Mm01_00189202 predicted 2143
9 SASI_Mm01_00189203 predicted 1245
10 SASI_Mm02_00327257 predicted 665
11 SASI_Mm01_00189199 predicted 1238
12 SASI_Mm01_00189204 predicted 1091
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020166
VALIDATED
MCCC1 MISSION shRNA Bacterial Glycerol Stock
methylcrotonoyl-CoA carboxylase 1 (alpha)
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000420604    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020166.3-1407s21c1
Sequence:CCGGGACGAAGTTTCCGTGCATTATCTCGAGATAATGCACGGAAACTTCGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078413    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_020166.2-2328s1c1
Sequence:CCGGGCCAGTTAAGTAGTGTCTTCTCTCGAGAGAAGACACTACTTAACTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078415    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A3
TRC Version: 1 Clone ID:NM_020166.2-1957s1c1
Sequence:CCGGGCGAAGCTGATTATCCTGGAACTCGAGTTCCAGGATAATCAGCTTCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078417    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_020166.2-2181s1c1
Sequence:CCGGGCATACCATAAAGTCTCCAAACTCGAGTTTGGAGACTTTATGGTATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078416    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A3
TRC Version: 1 Clone ID:NM_020166.2-859s1c1
Sequence:CCGGGCTATGCTGATCGAGAAGTTTCTCGAGAAACTTCTCGATCAGCATAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078414    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_020166.2-1958s1c1
Sequence:CCGGCGAAGCTGATTATCCTGGAAACTCGAGTTTCCAGGATAATCAGCTTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435159    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020166.3-1824s21c1
Sequence:CCGGGCCATAGCTGTAACGTATAACCTCGAGGTTATACGTTACAGCTATGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414951    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020166.3-1941s21c1
Sequence:CCGGGTTAATGGAGTTGCTAGTAAACTCGAGTTTACTAGCAACTCCATTAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020166
VALIDATED
MCCC1 MISSION shRNA shRNA Plasmid DNA
methylcrotonoyl-CoA carboxylase 1 (alpha)
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000420604    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020166.3-1407s21c1
Sequence:CCGGGACGAAGTTTCCGTGCATTATCTCGAGATAATGCACGGAAACTTCGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000078413    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_020166.2-2328s1c1
Sequence:CCGGGCCAGTTAAGTAGTGTCTTCTCTCGAGAGAAGACACTACTTAACTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000078415    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A3
TRC Version: 1 Clone ID:NM_020166.2-1957s1c1
Sequence:CCGGGCGAAGCTGATTATCCTGGAACTCGAGTTCCAGGATAATCAGCTTCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000078417    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_020166.2-2181s1c1
Sequence:CCGGGCATACCATAAAGTCTCCAAACTCGAGTTTGGAGACTTTATGGTATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000078416    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A3
TRC Version: 1 Clone ID:NM_020166.2-859s1c1
Sequence:CCGGGCTATGCTGATCGAGAAGTTTCTCGAGAAACTTCTCGATCAGCATAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000078414    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_020166.2-1958s1c1
Sequence:CCGGCGAAGCTGATTATCCTGGAAACTCGAGTTTCCAGGATAATCAGCTTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000435159    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020166.3-1824s21c1
Sequence:CCGGGCCATAGCTGTAACGTATAACCTCGAGGTTATACGTTACAGCTATGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000414951    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020166.3-1941s21c1
Sequence:CCGGGTTAATGGAGTTGCTAGTAAACTCGAGTTTACTAGCAACTCCATTAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020166
VALIDATED
MCCC1 MISSION shRNA Lentiviral Transduction Particles
methylcrotonoyl-CoA carboxylase 1 (alpha)
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000420604    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020166.3-1407s21c1
Sequence:CCGGGACGAAGTTTCCGTGCATTATCTCGAGATAATGCACGGAAACTTCGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078413    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_020166.2-2328s1c1
Sequence:CCGGGCCAGTTAAGTAGTGTCTTCTCTCGAGAGAAGACACTACTTAACTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078415    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A3
TRC Version: 1 Clone ID:NM_020166.2-1957s1c1
Sequence:CCGGGCGAAGCTGATTATCCTGGAACTCGAGTTCCAGGATAATCAGCTTCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078417    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_020166.2-2181s1c1
Sequence:CCGGGCATACCATAAAGTCTCCAAACTCGAGTTTGGAGACTTTATGGTATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078416    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A3
TRC Version: 1 Clone ID:NM_020166.2-859s1c1
Sequence:CCGGGCTATGCTGATCGAGAAGTTTCTCGAGAAACTTCTCGATCAGCATAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078414    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_020166.2-1958s1c1
Sequence:CCGGCGAAGCTGATTATCCTGGAAACTCGAGTTTCCAGGATAATCAGCTTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435159    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020166.3-1824s21c1
Sequence:CCGGGCCATAGCTGTAACGTATAACCTCGAGGTTATACGTTACAGCTATGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414951    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020166.3-1941s21c1
Sequence:CCGGGTTAATGGAGTTGCTAGTAAACTCGAGTTTACTAGCAACTCCATTAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_023644
VALIDATED
MCCC1 MISSION shRNA Bacterial Glycerol Stock
methylcrotonoyl-CoA carboxylase 1 (alpha)
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000112507    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023644.2-947s1c1
Sequence:CCGGCCTGGTATTAATCCTGAAGTACTCGAGTACTTCAGGATTAATACCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112506    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023644.2-2122s1c1
Sequence:CCGGGCATACCATAAAGGCTCCAAACTCGAGTTTGGAGCCTTTATGGTATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112508    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023644.2-773s1c1
Sequence:CCGGGAGGCGAAGAAGTCTTTCAATCTCGAGATTGAAAGACTTCTTCGCCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000334255    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_023644.4-2281s21c1
Sequence:CCGGGCAGTGAACTGTGTCCAGAAACTCGAGTTTCTGGACACAGTTCACTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112505    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023644.2-2245s1c1
Sequence:CCGGGCAGTGAACTGTGTCCAGAAACTCGAGTTTCTGGACACAGTTCACTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112509    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023644.2-1801s1c1
Sequence:CCGGGCAGATTGACAACAAGTCCTTCTCGAGAAGGACTTGTTGTCAATCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000348143    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023644.4-1795s21c1
Sequence:CCGGAGTCATAGCTGTGACGTATAACTCGAGTTATACGTCACAGCTATGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000334254    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023644.4-809s21c1
Sequence:CCGGGAGGCGAAGAAGTCTTTCAATCTCGAGATTGAAAGACTTCTTCGCCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000334188    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023644.4-1837s21c1
Sequence:CCGGGCAGATTGACAACAAGTCCTTCTCGAGAAGGACTTGTTGTCAATCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_023644
VALIDATED
MCCC1 MISSION shRNA shRNA Plasmid DNA
methylcrotonoyl-CoA carboxylase 1 (alpha)
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000112507    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023644.2-947s1c1
Sequence:CCGGCCTGGTATTAATCCTGAAGTACTCGAGTACTTCAGGATTAATACCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000112506    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023644.2-2122s1c1
Sequence:CCGGGCATACCATAAAGGCTCCAAACTCGAGTTTGGAGCCTTTATGGTATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000112508    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023644.2-773s1c1
Sequence:CCGGGAGGCGAAGAAGTCTTTCAATCTCGAGATTGAAAGACTTCTTCGCCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000334255    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_023644.4-2281s21c1
Sequence:CCGGGCAGTGAACTGTGTCCAGAAACTCGAGTTTCTGGACACAGTTCACTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000112505    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023644.2-2245s1c1
Sequence:CCGGGCAGTGAACTGTGTCCAGAAACTCGAGTTTCTGGACACAGTTCACTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000112509    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023644.2-1801s1c1
Sequence:CCGGGCAGATTGACAACAAGTCCTTCTCGAGAAGGACTTGTTGTCAATCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000348143    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023644.4-1795s21c1
Sequence:CCGGAGTCATAGCTGTGACGTATAACTCGAGTTATACGTCACAGCTATGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000334254    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023644.4-809s21c1
Sequence:CCGGGAGGCGAAGAAGTCTTTCAATCTCGAGATTGAAAGACTTCTTCGCCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000334188    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023644.4-1837s21c1
Sequence:CCGGGCAGATTGACAACAAGTCCTTCTCGAGAAGGACTTGTTGTCAATCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_023644
VALIDATED
MCCC1 MISSION shRNA Lentiviral Transduction Particles
methylcrotonoyl-CoA carboxylase 1 (alpha)
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000112507    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023644.2-947s1c1
Sequence:CCGGCCTGGTATTAATCCTGAAGTACTCGAGTACTTCAGGATTAATACCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112506    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023644.2-2122s1c1
Sequence:CCGGGCATACCATAAAGGCTCCAAACTCGAGTTTGGAGCCTTTATGGTATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112508    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023644.2-773s1c1
Sequence:CCGGGAGGCGAAGAAGTCTTTCAATCTCGAGATTGAAAGACTTCTTCGCCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000334255    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_023644.4-2281s21c1
Sequence:CCGGGCAGTGAACTGTGTCCAGAAACTCGAGTTTCTGGACACAGTTCACTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112505    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023644.2-2245s1c1
Sequence:CCGGGCAGTGAACTGTGTCCAGAAACTCGAGTTTCTGGACACAGTTCACTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112509    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023644.2-1801s1c1
Sequence:CCGGGCAGATTGACAACAAGTCCTTCTCGAGAAGGACTTGTTGTCAATCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000348143    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023644.4-1795s21c1
Sequence:CCGGAGTCATAGCTGTGACGTATAACTCGAGTTATACGTCACAGCTATGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000334254    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023644.4-809s21c1
Sequence:CCGGGAGGCGAAGAAGTCTTTCAATCTCGAGATTGAAAGACTTCTTCGCCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000334188    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023644.4-1837s21c1
Sequence:CCGGGCAGATTGACAACAAGTCCTTCTCGAGAAGGACTTGTTGTCAATCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)