EMAIL THIS PAGE TO A FRIEND

MCCC2

methylcrotonoyl-CoA carboxylase 2 (beta)

86 Gene Product Result for
Synonyms: MCCB
UniProtKB ID: Q9HCC0, A6NIY9, Q96C27, Q9Y4L7
Gene ID:
Human(64087) Summary: This gene encodes the small subunit of 3-methylcrotonyl-CoA carboxylase. This enzyme functions as a heterodimer and catalyzes the carboxylation of 3-methylcrotonyl-CoA to form 3-methylglutaconyl-CoA. Mutations in this gene are associated with 3-Methylcrotonylglycinuria, an autosomal recessive disorder of leucine catabolism. [provided by RefSeq, Jul 2008]
Mouse(78038) methylcrotonoyl-Coenzyme A carboxylase 2 (beta)
Rat(361884) methylcrotonoyl-CoA carboxylase 2 (beta)
sheep(101116765) methylcrotonoyl-CoA carboxylase 2 (beta)
naked mole-rat(101709282) methylcrotonoyl-CoA carboxylase 2 (beta)
domestic guinea pig(100712874) methylcrotonoyl-CoA carboxylase 2 (beta)
Zebrafish(405863) methylcrotonoyl-Coenzyme A carboxylase 2 (beta)
dog(478091) methylcrotonoyl-CoA carboxylase 2 (beta)
domestic cat(101090589) methylcrotonoyl-CoA carboxylase 2 (beta)
cow(783065) methylcrotonoyl-CoA carboxylase 2 (beta)
chicken(427395) methylcrotonoyl-CoA carboxylase 2 (beta)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_022132 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_022132 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_022132 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_030026 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_030026 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_030026 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_022132 Rosetta Predictions human pricing
NM_001012177 Rosetta Predictions rat pricing
XM_574842 Rosetta Predictions rat pricing
NM_030026 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022132 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00355535 predicted 1505
2 SASI_Hs02_00355536 predicted 1297
3 SASI_Hs01_00039625 predicted 428
4 SASI_Hs01_00039627 predicted 1024
5 SASI_Hs02_00355537 predicted 1192
6 SASI_Hs01_00039629 predicted 637
7 SASI_Hs01_00039630 predicted 1680
8 SASI_Hs01_00039631 predicted 934
9 SASI_Hs01_00039632 predicted 306
10 SASI_Hs01_00039633 predicted 499
11 SASI_Hs01_00039626 predicted 938
12 SASI_Hs01_00039628 predicted 572
13 SASI_Hs01_00039634 predicted 1212
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012177 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00115123 predicted 1031
2 SASI_Rn01_00115124 predicted 727
3 SASI_Rn01_00115125 predicted 1481
4 SASI_Rn01_00115126 predicted 1029
5 SASI_Rn01_00115127 predicted 373
6 SASI_Rn01_00115128 predicted 712
7 SASI_Rn01_00115129 predicted 1347
8 SASI_Rn01_00115130 predicted 431
9 SASI_Rn01_00115131 predicted 996
10 SASI_Rn01_00115132 predicted 533
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_574842 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00177312 predicted 1222
2 SASI_Rn01_00177313 predicted 915
3 SASI_Rn01_00177314 predicted 1678
4 SASI_Rn01_00177315 predicted 1216
5 SASI_Rn01_00177316 predicted 562
6 SASI_Rn01_00177317 predicted 906
7 SASI_Rn01_00177318 predicted 1540
8 SASI_Rn01_00177319 predicted 623
9 SASI_Rn01_00177320 predicted 1190
10 SASI_Rn01_00177321 predicted 732
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030026 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00118402 predicted 700
2 SASI_Mm01_00118403 predicted 378
3 SASI_Mm01_00118404 predicted 1642
4 SASI_Mm01_00118405 predicted 1020
5 SASI_Mm01_00118406 predicted 1564
6 SASI_Mm01_00118407 predicted 1169
7 SASI_Mm01_00118408 predicted 786
8 SASI_Mm01_00118409 predicted 986
9 SASI_Mm01_00118411 predicted 520
10 SASI_Mm02_00336404 predicted 276
11 SASI_Mm01_00118410 predicted 440
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_022132
VALIDATED
MCCC2 MISSION shRNA Bacterial Glycerol Stock
methylcrotonoyl-CoA carboxylase 2 (beta)
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000434299    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022132.4-2198s21c1
Sequence:CCGGTGGTTATGCTTGGTGATATTTCTCGAGAAATATCACCAAGCATAACCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413045    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022132.4-2056s21c1
Sequence:CCGGTAAAGCGGAGACAGTAATTTACTCGAGTAAATTACTGTCTCCGCTTTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424957    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022132.4-308s21c1
Sequence:CCGGATGAACGAGTGGAGCATATAACTCGAGTTATATGCTCCACTCGTTCATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427390    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022132.4-1002s21c1
Sequence:CCGGGAAGGTTGTGAGGAATCTAAACTCGAGTTTAGATTCCTCACAACCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078418    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_022132.3-2022s1c1
Sequence:CCGGCGGAGACAGTAATTTATGGTTCTCGAGAACCATAAATTACTGTCTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078419    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_022132.3-566s1c1
Sequence:CCGGCCCAAGAAATTGCCATGCAAACTCGAGTTTGCATGGCAATTTCTTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078420    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_022132.3-1472s1c1
Sequence:CCGGGCCCAAGATTTCTCTACATTTCTCGAGAAATGTAGAGAAATCTTGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078422    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_022132.3-311s1c1
Sequence:CCGGCCCGAGCACTTCACATATCAACTCGAGTTGATATGTGAAGTGCTCGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078421    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_022132.3-1402s1c1
Sequence:CCGGCCTAAGATAACCCTCATCATTCTCGAGAATGATGAGGGTTATCTTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426061    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022132.4-2245s21c1
Sequence:CCGGTGTTACTTCAGTGGCATAAAGCTCGAGCTTTATGCCACTGAAGTAACATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_022132
VALIDATED
MCCC2 MISSION shRNA shRNA Plasmid DNA
methylcrotonoyl-CoA carboxylase 2 (beta)
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000434299    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022132.4-2198s21c1
Sequence:CCGGTGGTTATGCTTGGTGATATTTCTCGAGAAATATCACCAAGCATAACCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000413045    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022132.4-2056s21c1
Sequence:CCGGTAAAGCGGAGACAGTAATTTACTCGAGTAAATTACTGTCTCCGCTTTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000424957    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022132.4-308s21c1
Sequence:CCGGATGAACGAGTGGAGCATATAACTCGAGTTATATGCTCCACTCGTTCATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000427390    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022132.4-1002s21c1
Sequence:CCGGGAAGGTTGTGAGGAATCTAAACTCGAGTTTAGATTCCTCACAACCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000078418    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_022132.3-2022s1c1
Sequence:CCGGCGGAGACAGTAATTTATGGTTCTCGAGAACCATAAATTACTGTCTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000078419    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_022132.3-566s1c1
Sequence:CCGGCCCAAGAAATTGCCATGCAAACTCGAGTTTGCATGGCAATTTCTTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000078420    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_022132.3-1472s1c1
Sequence:CCGGGCCCAAGATTTCTCTACATTTCTCGAGAAATGTAGAGAAATCTTGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000078422    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_022132.3-311s1c1
Sequence:CCGGCCCGAGCACTTCACATATCAACTCGAGTTGATATGTGAAGTGCTCGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000078421    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_022132.3-1402s1c1
Sequence:CCGGCCTAAGATAACCCTCATCATTCTCGAGAATGATGAGGGTTATCTTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000426061    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022132.4-2245s21c1
Sequence:CCGGTGTTACTTCAGTGGCATAAAGCTCGAGCTTTATGCCACTGAAGTAACATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_022132
VALIDATED
MCCC2 MISSION shRNA Lentiviral Transduction Particles
methylcrotonoyl-CoA carboxylase 2 (beta)
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000434299    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022132.4-2198s21c1
Sequence:CCGGTGGTTATGCTTGGTGATATTTCTCGAGAAATATCACCAAGCATAACCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413045    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022132.4-2056s21c1
Sequence:CCGGTAAAGCGGAGACAGTAATTTACTCGAGTAAATTACTGTCTCCGCTTTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424957    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022132.4-308s21c1
Sequence:CCGGATGAACGAGTGGAGCATATAACTCGAGTTATATGCTCCACTCGTTCATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427390    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022132.4-1002s21c1
Sequence:CCGGGAAGGTTGTGAGGAATCTAAACTCGAGTTTAGATTCCTCACAACCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078418    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_022132.3-2022s1c1
Sequence:CCGGCGGAGACAGTAATTTATGGTTCTCGAGAACCATAAATTACTGTCTCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078419    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_022132.3-566s1c1
Sequence:CCGGCCCAAGAAATTGCCATGCAAACTCGAGTTTGCATGGCAATTTCTTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078420    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_022132.3-1472s1c1
Sequence:CCGGGCCCAAGATTTCTCTACATTTCTCGAGAAATGTAGAGAAATCTTGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078422    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_022132.3-311s1c1
Sequence:CCGGCCCGAGCACTTCACATATCAACTCGAGTTGATATGTGAAGTGCTCGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078421    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_022132.3-1402s1c1
Sequence:CCGGCCTAAGATAACCCTCATCATTCTCGAGAATGATGAGGGTTATCTTAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426061    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022132.4-2245s21c1
Sequence:CCGGTGTTACTTCAGTGGCATAAAGCTCGAGCTTTATGCCACTGAAGTAACATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_030026
VALIDATED
MCCC2 MISSION shRNA Bacterial Glycerol Stock
methylcrotonoyl-CoA carboxylase 2 (beta)
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000177208    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030026.1-1415s1c1
Sequence:CCGGGTGCCTAAGATAACTGTCATACTCGAGTATGACAGTTATCTTAGGCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197773    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030026.1-988s1c1
Sequence:CCGGGAGGAGTCTCAATTATCAGAACTCGAGTTCTGATAATTGAGACTCCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200086    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030026.1-1108s1c1
Sequence:CCGGCCGAGAGGTCATTGCTAGAATCTCGAGATTCTAGCAATGACCTCTCGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000293099    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030026.2-1425s21c1
Sequence:CCGGGTGCCTAAGATAACTGTCATACTCGAGTATGACAGTTATCTTAGGCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000293101    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030026.2-378s21c1
Sequence:CCGGGACAGAATCGACAATCTCATACTCGAGTATGAGATTGTCGATTCTGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000293100    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030026.2-998s21c1
Sequence:CCGGGAGGAGTCTCAATTATCAGAACTCGAGTTCTGATAATTGAGACTCCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000298148    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030026.2-1118s21c1
Sequence:CCGGCCGAGAGGTCATTGCTAGAATCTCGAGATTCTAGCAATGACCTCTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000177366    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030026.1-368s1c1
Sequence:CCGGGACAGAATCGACAATCTCATACTCGAGTATGAGATTGTCGATTCTGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197905    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030026.1-693s1c1
Sequence:CCGGGCATATTCTATAATCAGGCAACTCGAGTTGCCTGATTATAGAATATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_030026
VALIDATED
MCCC2 MISSION shRNA shRNA Plasmid DNA
methylcrotonoyl-CoA carboxylase 2 (beta)
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000177208    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030026.1-1415s1c1
Sequence:CCGGGTGCCTAAGATAACTGTCATACTCGAGTATGACAGTTATCTTAGGCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000197773    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030026.1-988s1c1
Sequence:CCGGGAGGAGTCTCAATTATCAGAACTCGAGTTCTGATAATTGAGACTCCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000200086    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030026.1-1108s1c1
Sequence:CCGGCCGAGAGGTCATTGCTAGAATCTCGAGATTCTAGCAATGACCTCTCGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000293099    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030026.2-1425s21c1
Sequence:CCGGGTGCCTAAGATAACTGTCATACTCGAGTATGACAGTTATCTTAGGCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000293101    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030026.2-378s21c1
Sequence:CCGGGACAGAATCGACAATCTCATACTCGAGTATGAGATTGTCGATTCTGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000293100    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030026.2-998s21c1
Sequence:CCGGGAGGAGTCTCAATTATCAGAACTCGAGTTCTGATAATTGAGACTCCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000298148    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030026.2-1118s21c1
Sequence:CCGGCCGAGAGGTCATTGCTAGAATCTCGAGATTCTAGCAATGACCTCTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000177366    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030026.1-368s1c1
Sequence:CCGGGACAGAATCGACAATCTCATACTCGAGTATGAGATTGTCGATTCTGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000197905    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030026.1-693s1c1
Sequence:CCGGGCATATTCTATAATCAGGCAACTCGAGTTGCCTGATTATAGAATATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_030026
VALIDATED
MCCC2 MISSION shRNA Lentiviral Transduction Particles
methylcrotonoyl-CoA carboxylase 2 (beta)
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000177208    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030026.1-1415s1c1
Sequence:CCGGGTGCCTAAGATAACTGTCATACTCGAGTATGACAGTTATCTTAGGCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197773    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030026.1-988s1c1
Sequence:CCGGGAGGAGTCTCAATTATCAGAACTCGAGTTCTGATAATTGAGACTCCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200086    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030026.1-1108s1c1
Sequence:CCGGCCGAGAGGTCATTGCTAGAATCTCGAGATTCTAGCAATGACCTCTCGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000293099    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030026.2-1425s21c1
Sequence:CCGGGTGCCTAAGATAACTGTCATACTCGAGTATGACAGTTATCTTAGGCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000293101    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030026.2-378s21c1
Sequence:CCGGGACAGAATCGACAATCTCATACTCGAGTATGAGATTGTCGATTCTGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000293100    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030026.2-998s21c1
Sequence:CCGGGAGGAGTCTCAATTATCAGAACTCGAGTTCTGATAATTGAGACTCCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000298148    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030026.2-1118s21c1
Sequence:CCGGCCGAGAGGTCATTGCTAGAATCTCGAGATTCTAGCAATGACCTCTCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000177366    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030026.1-368s1c1
Sequence:CCGGGACAGAATCGACAATCTCATACTCGAGTATGAGATTGTCGATTCTGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197905    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030026.1-693s1c1
Sequence:CCGGGCATATTCTATAATCAGGCAACTCGAGTTGCCTGATTATAGAATATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)