EMAIL THIS PAGE TO A FRIEND

MCCD1

mitochondrial coiled-coil domain 1

42 Gene Product Result for
UniProtKB ID: P59942, A2AB29, B0UZB2, Q7RTY2
Gene ID:
dog(607150) mitochondrial coiled-coil domain 1
cow(617505) mitochondrial coiled-coil domain 1
domestic cat(101083590) mitochondrial coiled-coil domain 1
naked mole-rat(101714617) mitochondrial coiled-coil domain 1
sheep(101104614) mitochondrial coiled-coil domain 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001011700 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001011700 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001011700 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001011700 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001011700 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00306018 predicted 462
2 SASI_Hs01_00031349 predicted 463
3 SASI_Hs02_00306019 predicted 432
4 SASI_Hs02_00306020 predicted 393
5 SASI_Hs01_00031354 predicted 288
6 SASI_Hs01_00031355 predicted 470
7 SASI_Hs02_00306021 predicted 391
8 SASI_Hs02_00306022 predicted 388
9 SASI_Hs01_00031358 predicted 287
10 SASI_Hs02_00306023 predicted 378
11 SASI_Hs01_00031350 predicted 437
12 SASI_Hs01_00031351 predicted 399
13 SASI_Hs01_00031352 predicted 396
14 SASI_Hs01_00031353 predicted 434
15 SASI_Hs01_00031356 predicted 392
16 SASI_Hs01_00031357 predicted 231
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001011700
MCCD1 MISSION shRNA Bacterial Glycerol Stock
mitochondrial coiled-coil domain 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000166244    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001011700.1-180s1c1
Sequence:CCGGCAGACCAACTCCAGAGGAAATCTCGAGATTTCCTCTGGAGTTGGTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166765    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001011700.1-356s1c1
Sequence:CCGGCCAGAAGCTGAAGGAACAGATCTCGAGATCTGTTCCTTCAGCTTCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166345    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001011700.1-190s1c1
Sequence:CCGGCCAGAGGAAATGGGAAGATGACTCGAGTCATCTTCCCATTTCCTCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166282    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001011700.1-350s1c1
Sequence:CCGGCAAGATCCAGAAGCTGAAGGACTCGAGTCCTTCAGCTTCTGGATCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165639    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001011700.1-347s1c1
Sequence:CCGGGCTCAAGATCCAGAAGCTGAACTCGAGTTCAGCTTCTGGATCTTGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164660    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001011700.1-161s1c1
Sequence:CCGGCAAAGCAAGCATGGAAGAGCACTCGAGTGCTCTTCCATGCTTGCTTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160926    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001011700.1-515s1c1
Sequence:CCGGGAAAGTGGAAGAGACCACAAACTCGAGTTTGTGGTCTCTTCCACTTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164760    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001011700.1-185s1c1
Sequence:CCGGCAACTCCAGAGGAAATGGGAACTCGAGTTCCCATTTCCTCTGGAGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166245    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001011700.1-469s1c1
Sequence:CCGGCAGGAGCCTTGGGATCATAAACTCGAGTTTATGATCCCAAGGCTCCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001011700
MCCD1 MISSION shRNA shRNA Plasmid DNA
mitochondrial coiled-coil domain 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000166244    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001011700.1-180s1c1
Sequence:CCGGCAGACCAACTCCAGAGGAAATCTCGAGATTTCCTCTGGAGTTGGTCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000166765    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001011700.1-356s1c1
Sequence:CCGGCCAGAAGCTGAAGGAACAGATCTCGAGATCTGTTCCTTCAGCTTCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000166345    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001011700.1-190s1c1
Sequence:CCGGCCAGAGGAAATGGGAAGATGACTCGAGTCATCTTCCCATTTCCTCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000166282    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001011700.1-350s1c1
Sequence:CCGGCAAGATCCAGAAGCTGAAGGACTCGAGTCCTTCAGCTTCTGGATCTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000165639    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001011700.1-347s1c1
Sequence:CCGGGCTCAAGATCCAGAAGCTGAACTCGAGTTCAGCTTCTGGATCTTGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000164660    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001011700.1-161s1c1
Sequence:CCGGCAAAGCAAGCATGGAAGAGCACTCGAGTGCTCTTCCATGCTTGCTTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000160926    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001011700.1-515s1c1
Sequence:CCGGGAAAGTGGAAGAGACCACAAACTCGAGTTTGTGGTCTCTTCCACTTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000164760    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001011700.1-185s1c1
Sequence:CCGGCAACTCCAGAGGAAATGGGAACTCGAGTTCCCATTTCCTCTGGAGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000166245    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001011700.1-469s1c1
Sequence:CCGGCAGGAGCCTTGGGATCATAAACTCGAGTTTATGATCCCAAGGCTCCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001011700
MCCD1 MISSION shRNA Lentiviral Transduction Particles
mitochondrial coiled-coil domain 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000166244    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001011700.1-180s1c1
Sequence:CCGGCAGACCAACTCCAGAGGAAATCTCGAGATTTCCTCTGGAGTTGGTCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166765    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001011700.1-356s1c1
Sequence:CCGGCCAGAAGCTGAAGGAACAGATCTCGAGATCTGTTCCTTCAGCTTCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166345    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001011700.1-190s1c1
Sequence:CCGGCCAGAGGAAATGGGAAGATGACTCGAGTCATCTTCCCATTTCCTCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166282    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001011700.1-350s1c1
Sequence:CCGGCAAGATCCAGAAGCTGAAGGACTCGAGTCCTTCAGCTTCTGGATCTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165639    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001011700.1-347s1c1
Sequence:CCGGGCTCAAGATCCAGAAGCTGAACTCGAGTTCAGCTTCTGGATCTTGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164660    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001011700.1-161s1c1
Sequence:CCGGCAAAGCAAGCATGGAAGAGCACTCGAGTGCTCTTCCATGCTTGCTTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160926    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001011700.1-515s1c1
Sequence:CCGGGAAAGTGGAAGAGACCACAAACTCGAGTTTGTGGTCTCTTCCACTTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164760    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001011700.1-185s1c1
Sequence:CCGGCAACTCCAGAGGAAATGGGAACTCGAGTTCCCATTTCCTCTGGAGTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166245    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001011700.1-469s1c1
Sequence:CCGGCAGGAGCCTTGGGATCATAAACTCGAGTTTATGATCCCAAGGCTCCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)