EMAIL THIS PAGE TO A FRIEND

MCEE

methylmalonyl CoA epimerase

47 Gene Product Result for
Synonyms: GLOD2
UniProtKB ID: Q96PE7, Q53TP1, Q8WW63
Gene ID:
Human(84693) Summary: The product of this gene catalyzes the interconversion of D- and L-methylmalonyl-CoA during the degradation of branched chain amino acids. odd chain-length fatty acids, and other metabolites. Mutations in this gene result in methylmalonyl-CoA epimerase deficiency, which is presented as mild to moderate methylmalonic aciduria. [provided by RefSeq, Jul 2008]
Mouse(73724) methylmalonyl CoA epimerase
Rat(293829) methylmalonyl CoA epimerase
Zebrafish(553804) methylmalonyl CoA epimerase
cow(508170) methylmalonyl CoA epimerase
chicken(415385) methylmalonyl CoA epimerase
dog(479018) methylmalonyl CoA epimerase
domestic cat(101085468) methylmalonyl CoA epimerase
sheep(101117702) methylmalonyl CoA epimerase
naked mole-rat(101724683) methylmalonyl CoA epimerase
domestic guinea pig(100715623) methylmalonyl CoA epimerase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_032601 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032601 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032601 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_028626 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028626 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028626 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU047491 MISSION® esiRNA esiRNA human MCEE (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032601 Rosetta Predictions human pricing
NM_001106341 Rosetta Predictions rat pricing
NM_028626 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032601 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00360148 predicted 200
2 SASI_Hs02_00360149 predicted 198
3 SASI_Hs02_00360150 predicted 197
4 SASI_Hs01_00092426 predicted 189
5 SASI_Hs01_00092427 predicted 72
6 SASI_Hs01_00092430 predicted 323
7 SASI_Hs01_00092428 predicted 567
8 SASI_Hs01_00092429 predicted 67
9 SASI_Hs01_00092431 predicted 613
10 SASI_Hs01_00092432 predicted 558
11 SASI_Hs01_00092433 predicted 160
12 SASI_Hs01_00092434 predicted 621
13 SASI_Hs01_00092435 predicted 367
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106341 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00218018 predicted 506
2 SASI_Rn02_00218019 predicted 551
3 SASI_Rn02_00218020 predicted 377
4 SASI_Rn02_00218021 predicted 557
5 SASI_Rn02_00218022 predicted 263
6 SASI_Rn02_00218023 predicted 484
7 SASI_Rn02_00218024 predicted 439
8 SASI_Rn02_00218025 predicted 399
9 SASI_Rn02_00218026 predicted 221
10 SASI_Rn02_00218027 predicted 238
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028626 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00092412 predicted 333
2 SASI_Mm01_00092413 predicted 398
3 SASI_Mm01_00092414 predicted 416
4 SASI_Mm01_00092415 predicted 421
5 SASI_Mm01_00092416 predicted 458
6 SASI_Mm01_00092417 predicted 380
7 SASI_Mm01_00092419 predicted 288
8 SASI_Mm01_00092420 predicted 455
9 SASI_Mm01_00092421 predicted 399
10 SASI_Mm02_00334141 predicted 347
11 SASI_Mm01_00092418 predicted 433
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032601
VALIDATED
MCEE MISSION shRNA Bacterial Glycerol Stock
methylmalonyl CoA epimerase
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000049478    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032601.2-75s1c1
Sequence:CCGGCCATTCCAACAGTAAGAGCTTCTCGAGAAGCTCTTACTGTTGGAATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049480    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_032601.2-280s1c1
Sequence:CCGGCCTGGGAAATACCAAGATGGACTCGAGTCCATCTTGGTATTTCCCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049482    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_032601.2-404s1c1
Sequence:CCGGGCAGCTGTGATGGATTTGAAACTCGAGTTTCAAATCCATCACAGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049481    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_032601.2-438s1c1
Sequence:CCGGGCAGTCTAAGTGAAGAGGTCACTCGAGTGACCTCTTCACTTAGACTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049479    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032601.2-149s1c1
Sequence:CCGGCGACTCAACCATGTAGCCATACTCGAGTATGGCTACATGGTTGAGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000370745    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032601.3-417s21c1
Sequence:CCGGCATCGAGGTGGATAATATTAACTCGAGTTAATATTATCCACCTCGATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000352390    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032601.3-349s21c1
Sequence:CCGGTTGGGACGTGACAGTCCAATTCTCGAGAATTGGACTGTCACGTCCCAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000352409    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032601.3-658s21c1
Sequence:CCGGTCACTGCTTCCATCATGTAAACTCGAGTTTACATGATGGAAGCAGTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000363584    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032601.3-473s21c1
Sequence:CCGGGCAGTCTAAGTGAAGAGGTCACTCGAGTGACCTCTTCACTTAGACTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000327827    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032601.3-184s21c1
Sequence:CCGGCGACTCAACCATGTAGCCATACTCGAGTATGGCTACATGGTTGAGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000327900    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032601.3-439s21c1
Sequence:CCGGGCAGCTGTGATGGATTTGAAACTCGAGTTTCAAATCCATCACAGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032601
VALIDATED
MCEE MISSION shRNA shRNA Plasmid DNA
methylmalonyl CoA epimerase
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000049478    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032601.2-75s1c1
Sequence:CCGGCCATTCCAACAGTAAGAGCTTCTCGAGAAGCTCTTACTGTTGGAATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049480    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_032601.2-280s1c1
Sequence:CCGGCCTGGGAAATACCAAGATGGACTCGAGTCCATCTTGGTATTTCCCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049482    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_032601.2-404s1c1
Sequence:CCGGGCAGCTGTGATGGATTTGAAACTCGAGTTTCAAATCCATCACAGCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049481    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_032601.2-438s1c1
Sequence:CCGGGCAGTCTAAGTGAAGAGGTCACTCGAGTGACCTCTTCACTTAGACTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049479    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032601.2-149s1c1
Sequence:CCGGCGACTCAACCATGTAGCCATACTCGAGTATGGCTACATGGTTGAGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000370745    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032601.3-417s21c1
Sequence:CCGGCATCGAGGTGGATAATATTAACTCGAGTTAATATTATCCACCTCGATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000352390    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032601.3-349s21c1
Sequence:CCGGTTGGGACGTGACAGTCCAATTCTCGAGAATTGGACTGTCACGTCCCAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000352409    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032601.3-658s21c1
Sequence:CCGGTCACTGCTTCCATCATGTAAACTCGAGTTTACATGATGGAAGCAGTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000363584    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032601.3-473s21c1
Sequence:CCGGGCAGTCTAAGTGAAGAGGTCACTCGAGTGACCTCTTCACTTAGACTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000327827    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032601.3-184s21c1
Sequence:CCGGCGACTCAACCATGTAGCCATACTCGAGTATGGCTACATGGTTGAGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000327900    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032601.3-439s21c1
Sequence:CCGGGCAGCTGTGATGGATTTGAAACTCGAGTTTCAAATCCATCACAGCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032601
VALIDATED
MCEE MISSION shRNA Lentiviral Transduction Particles
methylmalonyl CoA epimerase
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000049478    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032601.2-75s1c1
Sequence:CCGGCCATTCCAACAGTAAGAGCTTCTCGAGAAGCTCTTACTGTTGGAATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049480    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_032601.2-280s1c1
Sequence:CCGGCCTGGGAAATACCAAGATGGACTCGAGTCCATCTTGGTATTTCCCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049482    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_032601.2-404s1c1
Sequence:CCGGGCAGCTGTGATGGATTTGAAACTCGAGTTTCAAATCCATCACAGCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049481    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_032601.2-438s1c1
Sequence:CCGGGCAGTCTAAGTGAAGAGGTCACTCGAGTGACCTCTTCACTTAGACTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049479    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032601.2-149s1c1
Sequence:CCGGCGACTCAACCATGTAGCCATACTCGAGTATGGCTACATGGTTGAGTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000370745    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032601.3-417s21c1
Sequence:CCGGCATCGAGGTGGATAATATTAACTCGAGTTAATATTATCCACCTCGATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000352390    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032601.3-349s21c1
Sequence:CCGGTTGGGACGTGACAGTCCAATTCTCGAGAATTGGACTGTCACGTCCCAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000352409    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032601.3-658s21c1
Sequence:CCGGTCACTGCTTCCATCATGTAAACTCGAGTTTACATGATGGAAGCAGTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000363584    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032601.3-473s21c1
Sequence:CCGGGCAGTCTAAGTGAAGAGGTCACTCGAGTGACCTCTTCACTTAGACTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000327827    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032601.3-184s21c1
Sequence:CCGGCGACTCAACCATGTAGCCATACTCGAGTATGGCTACATGGTTGAGTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000327900    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032601.3-439s21c1
Sequence:CCGGGCAGCTGTGATGGATTTGAAACTCGAGTTTCAAATCCATCACAGCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028626
VALIDATED
MCEE MISSION shRNA Bacterial Glycerol Stock
methylmalonyl CoA epimerase
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000201844    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028626.1-86s1c1
Sequence:CCGGGAGTCCAAACTTCAGTTGCAACTCGAGTTGCAACTGAAGTTTGGACTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000201592    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028626.1-491s1c1
Sequence:CCGGCACATGGGAAACCTGTGATTTCTCGAGAAATCACAGGTTTCCCATGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000201525    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028626.1-95s1c1
Sequence:CCGGCTTCAGTTGCAATAGGGAGAACTCGAGTTCTCCCTATTGCAACTGAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190260    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028626.1-127s1c1
Sequence:CCGGCCACAGTCCCAGTTTCAAGAACTCGAGTTCTTGAAACTGGGACTGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000342098    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028626.1-127s21c1
Sequence:CCGGCCACAGTCCCAGTTTCAAGAACTCGAGTTCTTGAAACTGGGACTGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000342019    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028626.1-491s21c1
Sequence:CCGGCACATGGGAAACCTGTGATTTCTCGAGAAATCACAGGTTTCCCATGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000342031    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028626.1-95s21c1
Sequence:CCGGCTTCAGTTGCAATAGGGAGAACTCGAGTTCTCCCTATTGCAACTGAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000342020    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028626.1-186s21c1
Sequence:CCGGGGCTGTAGCAGTGCCAGATTTCTCGAGAAATCTGGCACTGCTACAGCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028626
VALIDATED
MCEE MISSION shRNA shRNA Plasmid DNA
methylmalonyl CoA epimerase
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000201844    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028626.1-86s1c1
Sequence:CCGGGAGTCCAAACTTCAGTTGCAACTCGAGTTGCAACTGAAGTTTGGACTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000201592    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028626.1-491s1c1
Sequence:CCGGCACATGGGAAACCTGTGATTTCTCGAGAAATCACAGGTTTCCCATGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000201525    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028626.1-95s1c1
Sequence:CCGGCTTCAGTTGCAATAGGGAGAACTCGAGTTCTCCCTATTGCAACTGAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000190260    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028626.1-127s1c1
Sequence:CCGGCCACAGTCCCAGTTTCAAGAACTCGAGTTCTTGAAACTGGGACTGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000342098    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028626.1-127s21c1
Sequence:CCGGCCACAGTCCCAGTTTCAAGAACTCGAGTTCTTGAAACTGGGACTGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000342019    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028626.1-491s21c1
Sequence:CCGGCACATGGGAAACCTGTGATTTCTCGAGAAATCACAGGTTTCCCATGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000342031    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028626.1-95s21c1
Sequence:CCGGCTTCAGTTGCAATAGGGAGAACTCGAGTTCTCCCTATTGCAACTGAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000342020    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028626.1-186s21c1
Sequence:CCGGGGCTGTAGCAGTGCCAGATTTCTCGAGAAATCTGGCACTGCTACAGCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028626
VALIDATED
MCEE MISSION shRNA Lentiviral Transduction Particles
methylmalonyl CoA epimerase
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000201844    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028626.1-86s1c1
Sequence:CCGGGAGTCCAAACTTCAGTTGCAACTCGAGTTGCAACTGAAGTTTGGACTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000201592    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028626.1-491s1c1
Sequence:CCGGCACATGGGAAACCTGTGATTTCTCGAGAAATCACAGGTTTCCCATGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000201525    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028626.1-95s1c1
Sequence:CCGGCTTCAGTTGCAATAGGGAGAACTCGAGTTCTCCCTATTGCAACTGAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190260    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028626.1-127s1c1
Sequence:CCGGCCACAGTCCCAGTTTCAAGAACTCGAGTTCTTGAAACTGGGACTGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000342098    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028626.1-127s21c1
Sequence:CCGGCCACAGTCCCAGTTTCAAGAACTCGAGTTCTTGAAACTGGGACTGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000342019    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028626.1-491s21c1
Sequence:CCGGCACATGGGAAACCTGTGATTTCTCGAGAAATCACAGGTTTCCCATGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000342031    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028626.1-95s21c1
Sequence:CCGGCTTCAGTTGCAATAGGGAGAACTCGAGTTCTCCCTATTGCAACTGAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000342020    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028626.1-186s21c1
Sequence:CCGGGGCTGTAGCAGTGCCAGATTTCTCGAGAAATCTGGCACTGCTACAGCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)