EMAIL THIS PAGE TO A FRIEND

MCF2

MCF.2 cell line derived transforming sequence

113 Gene Product Result for
Synonyms: ARHGEF21 DBL
Gene ID:
Human(4168) Summary: The oncogenic protein encoded by this gene is a guanine nucleotide exchange factor (GEF) that exerts control over some members of the Rho family of small GTPases. Several transcript variants encoding different isoforms have been found for this gene. These isoforms exhibit different expression patterns and varying levels of GEF activity.[provided by RefSeq, Jan 2010]
Mouse(109904) mcf.2 transforming sequence
Rat(317598) MCF.2 cell line derived transforming sequence
domestic guinea pig(100715386) MCF.2 cell line derived transforming sequence
naked mole-rat(101723676) MCF.2 cell line derived transforming sequence
Domestic Rabbit(100342839) MCF.2 cell line derived transforming sequence
sheep(101123270) MCF.2 cell line derived transforming sequence
chicken(422253) MCF.2 cell line derived transforming sequence
domestic cat(101085698) MCF.2 cell line derived transforming sequence
cow(532185) MCF.2 cell line derived transforming sequence
Horse(100055597) MCF.2 cell line derived transforming sequence
dog(492176) MCF.2 cell line derived transforming sequence
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1301580 ANTI-MCF2 (C-TERM) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
immunohistochemistry, western blot pricing
SAB1412726 Anti-MCF2 antibody produced in mouse purified immunoglobulin human
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_133197 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_133197 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_133197 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_005369 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005369 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005369 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001099855 Rosetta Predictions human pricing
NM_005369 Rosetta Predictions human pricing
XM_229172 Rosetta Predictions rat pricing
XR_007354 Rosetta Predictions rat pricing
NM_133197 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001099855 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00321544 predicted 2365
2 SASI_Hs02_00321545 predicted 2581
3 SASI_Hs02_00321546 predicted 2812
4 SASI_Hs02_00321547 predicted 2359
5 SASI_Hs02_00321548 predicted 738
6 SASI_Hs02_00321549 predicted 1631
7 SASI_Hs02_00321550 predicted 650
8 SASI_Hs02_00321551 predicted 1543
9 SASI_Hs02_00321552 predicted 1927
10 SASI_Hs02_00321553 predicted 2347
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005369 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00130058 predicted 2326
2 SASI_Hs02_00339462 predicted 2525
3 SASI_Hs01_00130059 predicted 2758
4 SASI_Hs01_00130061 predicted 2317
5 SASI_Hs01_00130062 predicted 693
6 SASI_Hs01_00130066 predicted 1580
7 SASI_Hs01_00130067 predicted 596
8 SASI_Hs02_00339463 predicted 1494
9 SASI_Hs02_00339464 predicted 1871
10 SASI_Hs02_00339465 predicted 2298
11 SASI_Hs01_00130060 predicted 438
12 SASI_Hs01_00130063 predicted 354
13 SASI_Hs01_00130064 predicted 370
14 SASI_Hs01_00130065 predicted 336
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_229172 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00385872 predicted 325
2 SASI_Rn02_00385873 predicted 1768
3 SASI_Rn02_00385874 predicted 2002
4 SASI_Rn02_00385875 predicted 497
5 SASI_Rn02_00385876 predicted 1384
6 SASI_Rn02_00385877 predicted 372
7 SASI_Rn02_00385878 predicted 1176
8 SASI_Rn02_00385879 predicted 454
9 SASI_Rn02_00385880 predicted 310
10 SASI_Rn02_00385881 predicted 2038
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_007354 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00196356 predicted 325
2 SASI_Rn02_00414348 predicted 1757
3 SASI_Rn01_00196358 predicted 1994
4 SASI_Rn02_00414349 predicted 493
5 SASI_Rn01_00196360 predicted 1380
6 SASI_Rn01_00196362 predicted 373
7 SASI_Rn02_00414350 predicted 1167
8 SASI_Rn02_00414351 predicted 447
9 SASI_Rn01_00196364 predicted 305
10 SASI_Rn02_00414352 predicted 2034
11 SASI_Rn01_00196357 predicted 648
12 SASI_Rn01_00196359 predicted 919
13 SASI_Rn01_00196361 predicted 693
14 SASI_Rn01_00196363 predicted 677
15 SASI_Rn01_00196365 predicted 718
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133197 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00023919 predicted 437
2 SASI_Mm01_00023920 predicted 284
3 SASI_Mm01_00023921 predicted 1999
4 SASI_Mm02_00338383 predicted 270
5 SASI_Mm01_00023923 predicted 235
6 SASI_Mm01_00023924 predicted 309
7 SASI_Mm01_00023926 predicted 487
8 SASI_Mm01_00023927 predicted 2428
9 SASI_Mm02_00338384 predicted 1870
10 SASI_Mm01_00023928 predicted 1069
11 SASI_Mm01_00023922 predicted 864
12 SASI_Mm01_00023925 predicted 1269
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_133197
MCF2 MISSION shRNA Bacterial Glycerol Stock
MCF.2 cell line derived transforming sequence
Mouse
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000042653    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133197.1-1449s1c1
Sequence:CCGGCGGTCCAGAATGATATTCTTTCTCGAGAAAGAATATCATTCTGGACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042657    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133197.1-320s1c1
Sequence:CCGGGCTGACATACATTGATGACAACTCGAGTTGTCATCAATGTATGTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042656    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133197.1-2769s1c1
Sequence:CCGGGCAGCTTGGAATGGGATGTTACTCGAGTAACATCCCATTCCAAGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042654    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133197.1-187s1c1
Sequence:CCGGGCTTACACTTAGTCCTGGTTTCTCGAGAAACCAGGACTAAGTGTAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174066    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133197.1-2769s1c2
Sequence:CCGGGCAGCTTGGAATGGGATGTTACTCGAGTAACATCCCATTCCAAGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174067    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133197.1-320s1c2
Sequence:CCGGGCTGACATACATTGATGACAACTCGAGTTGTCATCAATGTATGTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_133197
MCF2 MISSION shRNA shRNA Plasmid DNA
MCF.2 cell line derived transforming sequence
Mouse
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000042653    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133197.1-1449s1c1
Sequence:CCGGCGGTCCAGAATGATATTCTTTCTCGAGAAAGAATATCATTCTGGACCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000042657    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133197.1-320s1c1
Sequence:CCGGGCTGACATACATTGATGACAACTCGAGTTGTCATCAATGTATGTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000042656    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133197.1-2769s1c1
Sequence:CCGGGCAGCTTGGAATGGGATGTTACTCGAGTAACATCCCATTCCAAGCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000042654    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133197.1-187s1c1
Sequence:CCGGGCTTACACTTAGTCCTGGTTTCTCGAGAAACCAGGACTAAGTGTAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000174066    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133197.1-2769s1c2
Sequence:CCGGGCAGCTTGGAATGGGATGTTACTCGAGTAACATCCCATTCCAAGCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000174067    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133197.1-320s1c2
Sequence:CCGGGCTGACATACATTGATGACAACTCGAGTTGTCATCAATGTATGTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_133197
MCF2 MISSION shRNA Lentiviral Transduction Particles
MCF.2 cell line derived transforming sequence
Mouse
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000042653    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133197.1-1449s1c1
Sequence:CCGGCGGTCCAGAATGATATTCTTTCTCGAGAAAGAATATCATTCTGGACCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042657    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133197.1-320s1c1
Sequence:CCGGGCTGACATACATTGATGACAACTCGAGTTGTCATCAATGTATGTCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042656    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133197.1-2769s1c1
Sequence:CCGGGCAGCTTGGAATGGGATGTTACTCGAGTAACATCCCATTCCAAGCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042654    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133197.1-187s1c1
Sequence:CCGGGCTTACACTTAGTCCTGGTTTCTCGAGAAACCAGGACTAAGTGTAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174066    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133197.1-2769s1c2
Sequence:CCGGGCAGCTTGGAATGGGATGTTACTCGAGTAACATCCCATTCCAAGCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174067    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133197.1-320s1c2
Sequence:CCGGGCTGACATACATTGATGACAACTCGAGTTGTCATCAATGTATGTCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005369
MCF2 MISSION shRNA Bacterial Glycerol Stock
MCF.2 cell line derived transforming sequence
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000038173    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005369.2-333s1c1
Sequence:CCGGGCCTAAATTACCAGTTGTTATCTCGAGATAACAACTGGTAATTTAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000038172    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005369.2-2864s1c1
Sequence:CCGGGCAACTATTTCTACCCTACTTCTCGAGAAGTAGGGTAGAAATAGTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000038171    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005369.2-984s1c1
Sequence:CCGGGCTATTATCAAAGGCCCAGTTCTCGAGAACTGGGCCTTTGATAATAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000038170    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005369.2-1665s1c1
Sequence:CCGGCCACGTACTAAATGAACTGATCTCGAGATCAGTTCATTTAGTACGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000038169    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005369.2-547s1c1
Sequence:CCGGCCAGATGATATTCCCTCAATACTCGAGTATTGAGGGAATATCATCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413199    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005369.4-2243s21c1
Sequence:CCGGATTGTTGAAGGAGCTATTAAACTCGAGTTTAATAGCTCCTTCAACAATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005369
MCF2 MISSION shRNA shRNA Plasmid DNA
MCF.2 cell line derived transforming sequence
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000038173    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005369.2-333s1c1
Sequence:CCGGGCCTAAATTACCAGTTGTTATCTCGAGATAACAACTGGTAATTTAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000038172    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005369.2-2864s1c1
Sequence:CCGGGCAACTATTTCTACCCTACTTCTCGAGAAGTAGGGTAGAAATAGTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000038171    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005369.2-984s1c1
Sequence:CCGGGCTATTATCAAAGGCCCAGTTCTCGAGAACTGGGCCTTTGATAATAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000038170    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005369.2-1665s1c1
Sequence:CCGGCCACGTACTAAATGAACTGATCTCGAGATCAGTTCATTTAGTACGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000038169    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005369.2-547s1c1
Sequence:CCGGCCAGATGATATTCCCTCAATACTCGAGTATTGAGGGAATATCATCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000413199    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005369.4-2243s21c1
Sequence:CCGGATTGTTGAAGGAGCTATTAAACTCGAGTTTAATAGCTCCTTCAACAATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005369
MCF2 MISSION shRNA Lentiviral Transduction Particles
MCF.2 cell line derived transforming sequence
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000038173    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005369.2-333s1c1
Sequence:CCGGGCCTAAATTACCAGTTGTTATCTCGAGATAACAACTGGTAATTTAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000038172    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005369.2-2864s1c1
Sequence:CCGGGCAACTATTTCTACCCTACTTCTCGAGAAGTAGGGTAGAAATAGTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000038171    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005369.2-984s1c1
Sequence:CCGGGCTATTATCAAAGGCCCAGTTCTCGAGAACTGGGCCTTTGATAATAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000038170    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005369.2-1665s1c1
Sequence:CCGGCCACGTACTAAATGAACTGATCTCGAGATCAGTTCATTTAGTACGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000038169    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005369.2-547s1c1
Sequence:CCGGCCAGATGATATTCCCTCAATACTCGAGTATTGAGGGAATATCATCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413199    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005369.4-2243s21c1
Sequence:CCGGATTGTTGAAGGAGCTATTAAACTCGAGTTTAATAGCTCCTTCAACAATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)