EMAIL THIS PAGE TO A FRIEND

MCF2L2

MCF.2 cell line derived transforming sequence-like 2

25 Gene Product Result for
Synonyms: ARHGEF22
UniProtKB ID: Q86YR7, O94942, Q6P2B8, Q6ZVJ5, Q8N318
Gene ID:
Zebrafish(100149630) MCF.2 cell line derived transforming sequence-like 2
chicken(424959) MCF.2 cell line derived transforming sequence-like 2
domestic cat(101099144) MCF.2 cell line derived transforming sequence-like 2
cow(100139125) MCF.2 cell line derived transforming sequence-like 2
dog(478646) MCF.2 cell line derived transforming sequence-like 2
domestic guinea pig(100726780) MCF.2 cell line derived transforming sequence-like 2
naked mole-rat(101723991) MCF.2 cell line derived transforming sequence-like 2
sheep(101109765) MCF.2 cell line derived transforming sequence-like 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_015078 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015078 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015078 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU032401 MISSION® esiRNA esiRNA human MCF2L2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015078 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015078 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00045349 predicted 2862
2 SASI_Hs01_00045350 predicted 2638
3 SASI_Hs01_00045352 predicted 525
4 SASI_Hs01_00045353 predicted 543
5 SASI_Hs01_00045354 predicted 933
6 SASI_Hs01_00045356 predicted 1473
7 SASI_Hs02_00346944 predicted 1947
8 SASI_Hs01_00045357 predicted 2657
9 SASI_Hs02_00346945 predicted 2425
10 SASI_Hs02_00346946 predicted 404
11 SASI_Hs01_00045351 predicted 2181
12 SASI_Hs01_00045355 predicted 1082
13 SASI_Hs01_00045358 predicted 1366
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015078
MCF2L2 MISSION shRNA Bacterial Glycerol Stock
MCF.2 cell line derived transforming sequence-like 2
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000425776    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015078.2-153s21c1
Sequence:CCGGGATCACTCATGTCGATGAAATCTCGAGATTTCATCGACATGAGTGATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047575    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015078.2-2760s1c1
Sequence:CCGGCCAGGGATTATCTCCTCATTACTCGAGTAATGAGGAGATAATCCCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047576    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015078.2-316s1c1
Sequence:CCGGCCAGATGAAGACTTCCTGAATCTCGAGATTCAGGAAGTCTTCATCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047573    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015078.2-466s1c1
Sequence:CCGGCCAGGAAACTTACAGCTCATACTCGAGTATGAGCTGTAAGTTTCCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047577    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015078.2-2121s1c1
Sequence:CCGGCGAATTTCACAACAGGACTTTCTCGAGAAAGTCCTGTTGTGAAATTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047574    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015078.2-1248s1c1
Sequence:CCGGGCTCATCCAAAGCCACCATTACTCGAGTAATGGTGGCTTTGGATGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413330    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015078.2-2644s21c1
Sequence:CCGGATTCACAAGGATCGTTATAAACTCGAGTTTATAACGATCCTTGTGAATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015078
MCF2L2 MISSION shRNA shRNA Plasmid DNA
MCF.2 cell line derived transforming sequence-like 2
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000425776    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015078.2-153s21c1
Sequence:CCGGGATCACTCATGTCGATGAAATCTCGAGATTTCATCGACATGAGTGATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000047575    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015078.2-2760s1c1
Sequence:CCGGCCAGGGATTATCTCCTCATTACTCGAGTAATGAGGAGATAATCCCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000047576    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015078.2-316s1c1
Sequence:CCGGCCAGATGAAGACTTCCTGAATCTCGAGATTCAGGAAGTCTTCATCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000047573    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015078.2-466s1c1
Sequence:CCGGCCAGGAAACTTACAGCTCATACTCGAGTATGAGCTGTAAGTTTCCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000047577    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015078.2-2121s1c1
Sequence:CCGGCGAATTTCACAACAGGACTTTCTCGAGAAAGTCCTGTTGTGAAATTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000047574    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015078.2-1248s1c1
Sequence:CCGGGCTCATCCAAAGCCACCATTACTCGAGTAATGGTGGCTTTGGATGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000413330    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015078.2-2644s21c1
Sequence:CCGGATTCACAAGGATCGTTATAAACTCGAGTTTATAACGATCCTTGTGAATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015078
MCF2L2 MISSION shRNA Lentiviral Transduction Particles
MCF.2 cell line derived transforming sequence-like 2
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000425776    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015078.2-153s21c1
Sequence:CCGGGATCACTCATGTCGATGAAATCTCGAGATTTCATCGACATGAGTGATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047575    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015078.2-2760s1c1
Sequence:CCGGCCAGGGATTATCTCCTCATTACTCGAGTAATGAGGAGATAATCCCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047576    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015078.2-316s1c1
Sequence:CCGGCCAGATGAAGACTTCCTGAATCTCGAGATTCAGGAAGTCTTCATCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047573    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015078.2-466s1c1
Sequence:CCGGCCAGGAAACTTACAGCTCATACTCGAGTATGAGCTGTAAGTTTCCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047577    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015078.2-2121s1c1
Sequence:CCGGCGAATTTCACAACAGGACTTTCTCGAGAAAGTCCTGTTGTGAAATTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047574    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015078.2-1248s1c1
Sequence:CCGGGCTCATCCAAAGCCACCATTACTCGAGTAATGGTGGCTTTGGATGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413330    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015078.2-2644s21c1
Sequence:CCGGATTCACAAGGATCGTTATAAACTCGAGTTTATAACGATCCTTGTGAATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)