EMAIL THIS PAGE TO A FRIEND

MCFD2

multiple coagulation factor deficiency 2

137 Gene Product Result for
Synonyms: F5F8D F5F8D2 LMAN1IP SDNSF
Gene ID:
Human(90411) Summary: This gene encodes a soluble luminal protein with two calmodulin-like EF-hand motifs at its C-terminus. This protein forms a complex with LAMN1 (lectin mannose binding protein 1; also known as ERGIC-53) that facilitates the transport of coagulation factors V (FV) and VIII (FVIII) from the endoplasmic reticulum to the Golgi apparatus via an endoplasmic reticulum Golgi intermediate compartment (ERGIC). Mutations in this gene cause combined deficiency of FV and FVIII (F5F8D); a rare autosomal recessive bleeding disorder characterized by mild to moderate bleeding and coordinate reduction in plasma FV and FVIII levels. This protein has also been shown to maintain stem cell potential in adult central nervous system and is a marker for testicular germ cell tumors. The 3' UTR of this gene contains a transposon-like human repeat element named 'THE 1'. A processed RNA pseudogene of this gene is on chromosome 6p22.1. Alternative splicing results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Jun 2010]
Mouse(193813) multiple coagulation factor deficiency 2
Rat(246117) multiple coagulation factor deficiency 2
Zebrafish(449676) multiple coagulation factor deficiency 2
dog(474582) multiple coagulation factor deficiency 2
cow(507787) MCFD2 protein-like
cow(616647) multiple coagulation factor deficiency 2
domestic cat(101081285) multiple coagulation factor deficiency 2
chicken(421413) multiple coagulation factor deficiency 2
sheep(101108469) multiple coagulation factor deficiency 2
naked mole-rat(101704044) multiple coagulation factor deficiency 2
domestic guinea pig(100723194) multiple coagulation factor deficiency 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_139279 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_139279 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_139279 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_139295 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_139295 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_139295 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_139279 Rosetta Predictions human pricing
NM_139253 Rosetta Predictions rat pricing
NM_139295 Rosetta Predictions mouse pricing
NM_176808 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_139279 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00364258 predicted 470
2 SASI_Hs02_00364259 predicted 485
3 SASI_Hs02_00364260 predicted 428
4 SASI_Hs02_00364261 predicted 420
5 SASI_Hs01_00096269 predicted 284
6 SASI_Hs02_00364262 predicted 296
7 SASI_Hs02_00364263 predicted 515
8 SASI_Hs02_00364264 predicted 494
9 SASI_Hs01_00096264 predicted 378
10 SASI_Hs02_00364265 predicted 399
11 SASI_Hs01_00096265 predicted 550
12 SASI_Hs01_00096266 predicted 286
13 SASI_Hs01_00096267 predicted 383
14 SASI_Hs01_00096268 predicted 202
15 SASI_Hs01_00096270 predicted 293
16 SASI_Hs01_00096271 predicted 233
17 SASI_Hs01_00096272 predicted 383
18 SASI_Hs01_00096273 predicted 242
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_139253 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00078889 predicted 1016
2 SASI_Rn01_00078891 predicted 691
3 SASI_Rn01_00078892 predicted 446
4 SASI_Rn01_00078893 predicted 533
5 SASI_Rn01_00078894 predicted 828
6 SASI_Rn01_00078895 predicted 677
7 SASI_Rn01_00078896 predicted 828
8 SASI_Rn01_00078897 predicted 431
9 SASI_Rn01_00078898 predicted 569
10 SASI_Rn02_00268534 predicted 942
11 SASI_Rn01_00078890 predicted 552
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_139295 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00166691 predicted 346
2 SASI_Mm01_00166692 predicted 946
3 SASI_Mm01_00166696 predicted 550
4 SASI_Mm01_00166695 predicted 720
5 SASI_Mm01_00166693 predicted 971
6 SASI_Mm01_00166694 predicted 488
7 SASI_Mm01_00166697 predicted 814
8 SASI_Mm01_00166698 predicted 831
9 SASI_Mm01_00166699 predicted 504
10 SASI_Mm02_00339981 predicted 906
11 SASI_Mm01_00166700 predicted 589
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_176808 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00123072 predicted 306
2 SASI_Mm01_00123073 predicted 909
3 SASI_Mm01_00123074 predicted 518
4 SASI_Mm01_00123075 predicted 691
5 SASI_Mm01_00123076 predicted 939
6 SASI_Mm01_00123077 predicted 454
7 SASI_Mm02_00346714 predicted 781
8 SASI_Mm01_00123078 predicted 796
9 SASI_Mm01_00123079 predicted 469
10 SASI_Mm01_00123080 predicted 870
11 SASI_Mm01_00123081 predicted 766
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_139279
VALIDATED
MCFD2 MISSION shRNA Bacterial Glycerol Stock
multiple coagulation factor deficiency 2
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000310481    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139279.3-214s21c1
Sequence:CCGGCCTGGATAAGAACACAGTGCACTCGAGTGCACTGTGTTCTTATCCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000299692    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139279.3-242s21c1
Sequence:CCGGGAGCATATCATGGAGCATCTACTCGAGTAGATGCTCCATGATATGCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000299691    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139279.3-419s21c1
Sequence:CCGGGCACCACTAATGAGTGAAGATCTCGAGATCTTCACTCATTAGTGGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000310476    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_139279.3-2438s21c1
Sequence:CCGGGCCTGGACTTTGTTGTCCATACTCGAGTATGGACAACAAAGTCCAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118737    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_139279.3-2438s1c1
Sequence:CCGGGCCTGGACTTTGTTGTCCATACTCGAGTATGGACAACAAAGTCCAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118739    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_139279.3-242s1c1
Sequence:CCGGGAGCATATCATGGAGCATCTACTCGAGTAGATGCTCCATGATATGCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118738    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_139279.3-419s1c1
Sequence:CCGGGCACCACTAATGAGTGAAGATCTCGAGATCTTCACTCATTAGTGGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118740    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_139279.3-470s1c1
Sequence:CCGGAGAGATGATGACAAGAACAATCTCGAGATTGTTCTTGTCATCATCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118741    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_139279.3-214s1c1
Sequence:CCGGCCTGGATAAGAACACAGTGCACTCGAGTGCACTGTGTTCTTATCCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000310479    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139279.3-470s21c1
Sequence:CCGGAGAGATGATGACAAGAACAATCTCGAGATTGTTCTTGTCATCATCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_139279
VALIDATED
MCFD2 MISSION shRNA shRNA Plasmid DNA
multiple coagulation factor deficiency 2
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000310481    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139279.3-214s21c1
Sequence:CCGGCCTGGATAAGAACACAGTGCACTCGAGTGCACTGTGTTCTTATCCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000299692    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139279.3-242s21c1
Sequence:CCGGGAGCATATCATGGAGCATCTACTCGAGTAGATGCTCCATGATATGCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000299691    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139279.3-419s21c1
Sequence:CCGGGCACCACTAATGAGTGAAGATCTCGAGATCTTCACTCATTAGTGGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000310476    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_139279.3-2438s21c1
Sequence:CCGGGCCTGGACTTTGTTGTCCATACTCGAGTATGGACAACAAAGTCCAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000118737    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_139279.3-2438s1c1
Sequence:CCGGGCCTGGACTTTGTTGTCCATACTCGAGTATGGACAACAAAGTCCAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000118739    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_139279.3-242s1c1
Sequence:CCGGGAGCATATCATGGAGCATCTACTCGAGTAGATGCTCCATGATATGCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000118738    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_139279.3-419s1c1
Sequence:CCGGGCACCACTAATGAGTGAAGATCTCGAGATCTTCACTCATTAGTGGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000118740    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_139279.3-470s1c1
Sequence:CCGGAGAGATGATGACAAGAACAATCTCGAGATTGTTCTTGTCATCATCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000118741    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_139279.3-214s1c1
Sequence:CCGGCCTGGATAAGAACACAGTGCACTCGAGTGCACTGTGTTCTTATCCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000310479    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139279.3-470s21c1
Sequence:CCGGAGAGATGATGACAAGAACAATCTCGAGATTGTTCTTGTCATCATCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_139279
VALIDATED
MCFD2 MISSION shRNA Lentiviral Transduction Particles
multiple coagulation factor deficiency 2
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000310481    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139279.3-214s21c1
Sequence:CCGGCCTGGATAAGAACACAGTGCACTCGAGTGCACTGTGTTCTTATCCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000299692    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139279.3-242s21c1
Sequence:CCGGGAGCATATCATGGAGCATCTACTCGAGTAGATGCTCCATGATATGCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000299691    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139279.3-419s21c1
Sequence:CCGGGCACCACTAATGAGTGAAGATCTCGAGATCTTCACTCATTAGTGGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000310476    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_139279.3-2438s21c1
Sequence:CCGGGCCTGGACTTTGTTGTCCATACTCGAGTATGGACAACAAAGTCCAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118737    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_139279.3-2438s1c1
Sequence:CCGGGCCTGGACTTTGTTGTCCATACTCGAGTATGGACAACAAAGTCCAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118739    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_139279.3-242s1c1
Sequence:CCGGGAGCATATCATGGAGCATCTACTCGAGTAGATGCTCCATGATATGCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118738    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_139279.3-419s1c1
Sequence:CCGGGCACCACTAATGAGTGAAGATCTCGAGATCTTCACTCATTAGTGGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118740    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_139279.3-470s1c1
Sequence:CCGGAGAGATGATGACAAGAACAATCTCGAGATTGTTCTTGTCATCATCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118741    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_139279.3-214s1c1
Sequence:CCGGCCTGGATAAGAACACAGTGCACTCGAGTGCACTGTGTTCTTATCCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000310479    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139279.3-470s21c1
Sequence:CCGGAGAGATGATGACAAGAACAATCTCGAGATTGTTCTTGTCATCATCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_139295
MCFD2 MISSION shRNA Bacterial Glycerol Stock
multiple coagulation factor deficiency 2
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000178896    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_139295.1-974s1c1
Sequence:CCGGCCAGGCATACAGCATCATATACTCGAGTATATGATGCTGTATGCCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183004    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_139295.1-1571s1c1
Sequence:CCGGCGTAAGAGAATCCAGAATGATCTCGAGATCATTCTGGATTCTCTTACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196018    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139295.1-469s1c1
Sequence:CCGGGAGGGACGATGACAAGAACAACTCGAGTTGTTCTTGTCATCGTCCCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183944    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139295.1-496s1c1
Sequence:CCGGCTACATCGACTACGCTGAGTTCTCGAGAACTCAGCGTAGTCGATGTAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_139295
MCFD2 MISSION shRNA shRNA Plasmid DNA
multiple coagulation factor deficiency 2
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000178896    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_139295.1-974s1c1
Sequence:CCGGCCAGGCATACAGCATCATATACTCGAGTATATGATGCTGTATGCCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000183004    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_139295.1-1571s1c1
Sequence:CCGGCGTAAGAGAATCCAGAATGATCTCGAGATCATTCTGGATTCTCTTACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000196018    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139295.1-469s1c1
Sequence:CCGGGAGGGACGATGACAAGAACAACTCGAGTTGTTCTTGTCATCGTCCCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000183944    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139295.1-496s1c1
Sequence:CCGGCTACATCGACTACGCTGAGTTCTCGAGAACTCAGCGTAGTCGATGTAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_139295
MCFD2 MISSION shRNA Lentiviral Transduction Particles
multiple coagulation factor deficiency 2
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000178896    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_139295.1-974s1c1
Sequence:CCGGCCAGGCATACAGCATCATATACTCGAGTATATGATGCTGTATGCCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183004    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_139295.1-1571s1c1
Sequence:CCGGCGTAAGAGAATCCAGAATGATCTCGAGATCATTCTGGATTCTCTTACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196018    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139295.1-469s1c1
Sequence:CCGGGAGGGACGATGACAAGAACAACTCGAGTTGTTCTTGTCATCGTCCCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183944    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139295.1-496s1c1
Sequence:CCGGCTACATCGACTACGCTGAGTTCTCGAGAACTCAGCGTAGTCGATGTAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)