EMAIL THIS PAGE TO A FRIEND

MCHR1

melanin-concentrating hormone receptor 1

112 Gene Product Result for
Synonyms: GPR24 MCH-1R MCH1R SLC-1 SLC1
UniProtKB ID: Q99705, B2RBX6, Q5R3J1, Q96S47, Q9BV08
Gene ID:
Human(2847) Summary: The protein encoded by this gene, a member of the G protein-coupled receptor family 1, is an integral plasma membrane protein which binds melanin-concentrating hormone. The encoded protein can inhibit cAMP accumulation and stimulate intracellular calcium flux, and is probably involved in the neuronal regulation of food consumption. Although structurally similar to somatostatin receptors, this protein does not seem to bind somatostatin. [provided by RefSeq, Jul 2008]
Mouse(207911) melanin-concentrating hormone receptor 1
Rat(83567) melanin-concentrating hormone receptor 1
sheep(101108822) melanin-concentrating hormone receptor 1
domestic guinea pig(100733698) melanin-concentrating hormone receptor 1
naked mole-rat(101715434) melanin-concentrating hormone receptor 1
chicken(769854) melanin-concentrating hormone receptor 1
dog(403563) melanin-concentrating hormone receptor 1
domestic cat(101086323) melanin-concentrating hormone receptor 1
cow(540119) melanin-concentrating hormone receptor 1
Horse(100055460) melanin-concentrating hormone receptor 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005297 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005297 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005297 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_145132 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_145132 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_145132 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005297 Rosetta Predictions human pricing
NM_031758 Rosetta Predictions rat pricing
NM_145132 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005297 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00095644 predicted 1285
2 SASI_Hs01_00095645 predicted 1609
3 SASI_Hs01_00095646 predicted 1611
4 SASI_Hs02_00339353 predicted 1963
5 SASI_Hs01_00095648 predicted 1431
6 SASI_Hs01_00095650 predicted 1791
7 SASI_Hs01_00095651 predicted 844
8 SASI_Hs01_00095652 predicted 1948
9 SASI_Hs01_00095653 predicted 2002
10 SASI_Hs02_00339354 predicted 1810
11 SASI_Hs01_00095647 predicted 1259
12 SASI_Hs01_00095649 predicted 1786
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031758 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00034282 predicted 378
2 SASI_Rn02_00265173 predicted 824
3 SASI_Rn01_00034283 predicted 351
4 SASI_Rn02_00265174 predicted 393
5 SASI_Rn01_00034284 predicted 425
6 SASI_Rn01_00034285 predicted 407
7 SASI_Rn01_00034286 predicted 876
8 SASI_Rn01_00034288 predicted 658
9 SASI_Rn01_00034289 predicted 382
10 SASI_Rn01_00034290 predicted 955
11 SASI_Rn01_00034287 predicted 643
12 SASI_Rn01_00034291 predicted 276
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145132 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00119086 predicted 247
2 SASI_Mm01_00119087 predicted 361
3 SASI_Mm01_00119088 predicted 336
4 SASI_Mm01_00119089 predicted 505
5 SASI_Mm01_00119090 predicted 310
6 SASI_Mm01_00119091 predicted 391
7 SASI_Mm01_00119092 predicted 766
8 SASI_Mm02_00340519 predicted 304
9 SASI_Mm01_00119093 predicted 531
10 SASI_Mm01_00119094 predicted 221
11 SASI_Mm01_00119085 predicted 372
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005297
MCHR1 MISSION shRNA Bacterial Glycerol Stock
melanin-concentrating hormone receptor 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000008859    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005297.2-1702s1c1
Sequence:CCGGGCAGGATGAGACCTTTGGATACTCGAGTATCCAAAGGTCTCATCCTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008860    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005297.2-1198s1c1
Sequence:CCGGGCCATCTGTCTGGTCTTCTTTCTCGAGAAAGAAGACCAGACAGATGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008862    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005297.2-588s1c1
Sequence:CCGGCGGGAACTCCACGGTCATCTTCTCGAGAAGATGACCGTGGAGTTCCCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008863    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005297.2-522s1c1
Sequence:CCGGGAGCATCTCCTACATCAACATCTCGAGATGTTGATGTAGGAGATGCTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008861    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005297.2-1278s1c1
Sequence:CCGGCCTCACCTTTGTCTACTTATACTCGAGTATAAGTAGACAAAGGTGAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357145    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005297.3-1812s21c1
Sequence:CCGGGATAACCGGTTGCACTATATCCTCGAGGATATAGTGCAACCGGTTATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357148    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005297.3-2011s21c1
Sequence:CCGGTCTCCCAAGCTGGTGGATAATCTCGAGATTATCCACCAGCTTGGGAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357147    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005297.3-831s21c1
Sequence:CCGGTCACGGCCATGGATGCCAATACTCGAGTATTGGCATCCATGGCCGTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357146    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005297.3-1334s21c1
Sequence:CCGGCTCACCTTTGTCTACTTATACCTCGAGGTATAAGTAGACAAAGGTGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005297
MCHR1 MISSION shRNA shRNA Plasmid DNA
melanin-concentrating hormone receptor 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000008859    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005297.2-1702s1c1
Sequence:CCGGGCAGGATGAGACCTTTGGATACTCGAGTATCCAAAGGTCTCATCCTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000008860    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005297.2-1198s1c1
Sequence:CCGGGCCATCTGTCTGGTCTTCTTTCTCGAGAAAGAAGACCAGACAGATGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000008862    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005297.2-588s1c1
Sequence:CCGGCGGGAACTCCACGGTCATCTTCTCGAGAAGATGACCGTGGAGTTCCCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000008863    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005297.2-522s1c1
Sequence:CCGGGAGCATCTCCTACATCAACATCTCGAGATGTTGATGTAGGAGATGCTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000008861    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005297.2-1278s1c1
Sequence:CCGGCCTCACCTTTGTCTACTTATACTCGAGTATAAGTAGACAAAGGTGAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000357145    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005297.3-1812s21c1
Sequence:CCGGGATAACCGGTTGCACTATATCCTCGAGGATATAGTGCAACCGGTTATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000357148    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005297.3-2011s21c1
Sequence:CCGGTCTCCCAAGCTGGTGGATAATCTCGAGATTATCCACCAGCTTGGGAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000357147    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005297.3-831s21c1
Sequence:CCGGTCACGGCCATGGATGCCAATACTCGAGTATTGGCATCCATGGCCGTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000357146    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005297.3-1334s21c1
Sequence:CCGGCTCACCTTTGTCTACTTATACCTCGAGGTATAAGTAGACAAAGGTGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005297
MCHR1 MISSION shRNA Lentiviral Transduction Particles
melanin-concentrating hormone receptor 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000008859    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005297.2-1702s1c1
Sequence:CCGGGCAGGATGAGACCTTTGGATACTCGAGTATCCAAAGGTCTCATCCTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008860    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005297.2-1198s1c1
Sequence:CCGGGCCATCTGTCTGGTCTTCTTTCTCGAGAAAGAAGACCAGACAGATGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008862    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005297.2-588s1c1
Sequence:CCGGCGGGAACTCCACGGTCATCTTCTCGAGAAGATGACCGTGGAGTTCCCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008863    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005297.2-522s1c1
Sequence:CCGGGAGCATCTCCTACATCAACATCTCGAGATGTTGATGTAGGAGATGCTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008861    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005297.2-1278s1c1
Sequence:CCGGCCTCACCTTTGTCTACTTATACTCGAGTATAAGTAGACAAAGGTGAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357145    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005297.3-1812s21c1
Sequence:CCGGGATAACCGGTTGCACTATATCCTCGAGGATATAGTGCAACCGGTTATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357148    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005297.3-2011s21c1
Sequence:CCGGTCTCCCAAGCTGGTGGATAATCTCGAGATTATCCACCAGCTTGGGAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357147    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005297.3-831s21c1
Sequence:CCGGTCACGGCCATGGATGCCAATACTCGAGTATTGGCATCCATGGCCGTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357146    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005297.3-1334s21c1
Sequence:CCGGCTCACCTTTGTCTACTTATACCTCGAGGTATAAGTAGACAAAGGTGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145132
MCHR1 MISSION shRNA Bacterial Glycerol Stock
melanin-concentrating hormone receptor 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000028364    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145132.1-595s1c1
Sequence:CCGGCCAAACCCAGATACTGATCTTCTCGAGAAGATCAGTATCTGGGTTTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028368    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145132.1-912s1c1
Sequence:CCGGCTGCCTCAATCCCTTTGTGTACTCGAGTACACAAAGGGATTGAGGCAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028348    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145132.1-129s1c1
Sequence:CCGGGCCTTCAGTGTTTGGTACCATCTCGAGATGGTACCAAACACTGAAGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028365    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145132.1-231s1c1
Sequence:CCGGCCCTGACATCTTCATCATCAACTCGAGTTGATGATGAAGATGTCAGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028357    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145132.1-858s1c1
Sequence:CCGGCCTCACATTCGTCTACCTGTACTCGAGTACAGGTAGACGAATGTGAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145132
MCHR1 MISSION shRNA shRNA Plasmid DNA
melanin-concentrating hormone receptor 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000028364    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145132.1-595s1c1
Sequence:CCGGCCAAACCCAGATACTGATCTTCTCGAGAAGATCAGTATCTGGGTTTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000028368    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145132.1-912s1c1
Sequence:CCGGCTGCCTCAATCCCTTTGTGTACTCGAGTACACAAAGGGATTGAGGCAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000028348    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145132.1-129s1c1
Sequence:CCGGGCCTTCAGTGTTTGGTACCATCTCGAGATGGTACCAAACACTGAAGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000028365    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145132.1-231s1c1
Sequence:CCGGCCCTGACATCTTCATCATCAACTCGAGTTGATGATGAAGATGTCAGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000028357    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145132.1-858s1c1
Sequence:CCGGCCTCACATTCGTCTACCTGTACTCGAGTACAGGTAGACGAATGTGAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145132
MCHR1 MISSION shRNA Lentiviral Transduction Particles
melanin-concentrating hormone receptor 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000028364    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145132.1-595s1c1
Sequence:CCGGCCAAACCCAGATACTGATCTTCTCGAGAAGATCAGTATCTGGGTTTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028368    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145132.1-912s1c1
Sequence:CCGGCTGCCTCAATCCCTTTGTGTACTCGAGTACACAAAGGGATTGAGGCAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028348    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145132.1-129s1c1
Sequence:CCGGGCCTTCAGTGTTTGGTACCATCTCGAGATGGTACCAAACACTGAAGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028365    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145132.1-231s1c1
Sequence:CCGGCCCTGACATCTTCATCATCAACTCGAGTTGATGATGAAGATGTCAGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028357    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145132.1-858s1c1
Sequence:CCGGCCTCACATTCGTCTACCTGTACTCGAGTACAGGTAGACGAATGTGAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)