EMAIL THIS PAGE TO A FRIEND

MCHR2

melanin-concentrating hormone receptor 2

105 Gene Product Result for
Synonyms: GPR145 GPRv17 MCH-2R MCH-R2 MCH2 MCH2R MCHR-2 SLT
UniProtKB ID: Q969V1, B3KVW4, E1P5D7, Q5VTV7, Q6Q377, Q9BXA8
Gene ID:
Zebrafish(353182) melanin-concentrating hormone receptor 2
cow(782111) melanin-concentrating hormone receptor 2
domestic cat(101086149) melanin-concentrating hormone receptor 2
dog(403562) melanin-concentrating hormone receptor 2
sheep(101112067) melanin-concentrating hormone receptor 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_032503 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032503 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032503 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU012701 MISSION® esiRNA esiRNA targeting human MCHR2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001040179 Rosetta Predictions human pricing
NM_032503 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001040179 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00308882 predicted 1307
2 SASI_Hs02_00308883 predicted 1467
3 SASI_Hs02_00308884 predicted 1412
4 SASI_Hs02_00308885 predicted 1570
5 SASI_Hs02_00308886 predicted 1352
6 SASI_Hs01_00170764 predicted 643
7 SASI_Hs02_00308887 predicted 1362
8 SASI_Hs02_00308888 predicted 1384
9 SASI_Hs01_00170768 predicted 657
10 SASI_Hs02_00308889 predicted 1491
11 SASI_Hs01_00170759 predicted 680
12 SASI_Hs01_00170760 predicted 641
13 SASI_Hs01_00170761 predicted 642
14 SASI_Hs01_00170762 predicted 678
15 SASI_Hs01_00170763 predicted 646
16 SASI_Hs01_00170765 predicted 654
17 SASI_Hs01_00170766 predicted 679
18 SASI_Hs01_00170767 predicted 649
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032503 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00359981 predicted 1079
2 SASI_Hs02_00359982 predicted 1244
3 SASI_Hs02_00359983 predicted 1184
4 SASI_Hs02_00359984 predicted 1348
5 SASI_Hs02_00359985 predicted 1129
6 SASI_Hs01_00130296 predicted 423
7 SASI_Hs02_00359986 predicted 1139
8 SASI_Hs02_00359987 predicted 1155
9 SASI_Hs01_00130300 predicted 431
10 SASI_Hs02_00359988 predicted 1263
11 SASI_Hs01_00130291 predicted 471
12 SASI_Hs01_00130292 predicted 442
13 SASI_Hs01_00130293 predicted 436
14 SASI_Hs01_00130294 predicted 472
15 SASI_Hs01_00130295 predicted 436
16 SASI_Hs01_00130297 predicted 447
17 SASI_Hs01_00130298 predicted 481
18 SASI_Hs01_00130299 predicted 441
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032503
MCHR2 MISSION shRNA Bacterial Glycerol Stock
melanin-concentrating hormone receptor 2
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000363190    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032503.2-937s21c1
Sequence:CCGGGGCCTTCTATGTGGGTTATTACTCGAGTAATAACCCACATAGAAGGCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000358013    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032503.2-1150s21c1
Sequence:CCGGTGTCTATCTTACTGGTATTATCTCGAGATAATACCAGTAAGATAGACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000363165    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032503.2-249s21c1
Sequence:CCGGTCCTCATTGTATTCACTATAACTCGAGTTATAGTGAATACAATGAGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000358089    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032503.2-534s21c1
Sequence:CCGGACAAGACCATCCGGATCAATTCTCGAGAATTGATCCGGATGGTCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014358    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032503.1-1159s1c1
Sequence:CCGGCTAGACATGATTGTCTATCTTCTCGAGAAGATAGACAATCATGTCTAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014360    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032503.1-682s1c1
Sequence:CCGGCCTGACGATGTACTCTGGTATCTCGAGATACCAGAGTACATCGTCAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014362    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032503.1-167s1c1
Sequence:CCGGCCTGGAATAAAGAGTTTGCTTCTCGAGAAGCAAACTCTTTATTCCAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014361    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032503.1-648s1c1
Sequence:CCGGCGGTGTTGAGAGTTGTGCTTTCTCGAGAAAGCACAACTCTCAACACCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014359    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032503.1-443s1c1
Sequence:CCGGCCCTGGATACTTGTAACCAATCTCGAGATTGGTTACAAGTATCCAGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032503
MCHR2 MISSION shRNA shRNA Plasmid DNA
melanin-concentrating hormone receptor 2
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000363190    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032503.2-937s21c1
Sequence:CCGGGGCCTTCTATGTGGGTTATTACTCGAGTAATAACCCACATAGAAGGCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000358013    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032503.2-1150s21c1
Sequence:CCGGTGTCTATCTTACTGGTATTATCTCGAGATAATACCAGTAAGATAGACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000363165    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032503.2-249s21c1
Sequence:CCGGTCCTCATTGTATTCACTATAACTCGAGTTATAGTGAATACAATGAGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000358089    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032503.2-534s21c1
Sequence:CCGGACAAGACCATCCGGATCAATTCTCGAGAATTGATCCGGATGGTCTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000014358    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032503.1-1159s1c1
Sequence:CCGGCTAGACATGATTGTCTATCTTCTCGAGAAGATAGACAATCATGTCTAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000014360    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032503.1-682s1c1
Sequence:CCGGCCTGACGATGTACTCTGGTATCTCGAGATACCAGAGTACATCGTCAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000014362    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032503.1-167s1c1
Sequence:CCGGCCTGGAATAAAGAGTTTGCTTCTCGAGAAGCAAACTCTTTATTCCAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000014361    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032503.1-648s1c1
Sequence:CCGGCGGTGTTGAGAGTTGTGCTTTCTCGAGAAAGCACAACTCTCAACACCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000014359    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032503.1-443s1c1
Sequence:CCGGCCCTGGATACTTGTAACCAATCTCGAGATTGGTTACAAGTATCCAGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032503
MCHR2 MISSION shRNA Lentiviral Transduction Particles
melanin-concentrating hormone receptor 2
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000363190    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032503.2-937s21c1
Sequence:CCGGGGCCTTCTATGTGGGTTATTACTCGAGTAATAACCCACATAGAAGGCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000358013    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032503.2-1150s21c1
Sequence:CCGGTGTCTATCTTACTGGTATTATCTCGAGATAATACCAGTAAGATAGACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000363165    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032503.2-249s21c1
Sequence:CCGGTCCTCATTGTATTCACTATAACTCGAGTTATAGTGAATACAATGAGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000358089    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032503.2-534s21c1
Sequence:CCGGACAAGACCATCCGGATCAATTCTCGAGAATTGATCCGGATGGTCTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014358    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032503.1-1159s1c1
Sequence:CCGGCTAGACATGATTGTCTATCTTCTCGAGAAGATAGACAATCATGTCTAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014360    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032503.1-682s1c1
Sequence:CCGGCCTGACGATGTACTCTGGTATCTCGAGATACCAGAGTACATCGTCAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014362    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032503.1-167s1c1
Sequence:CCGGCCTGGAATAAAGAGTTTGCTTCTCGAGAAGCAAACTCTTTATTCCAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014361    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032503.1-648s1c1
Sequence:CCGGCGGTGTTGAGAGTTGTGCTTTCTCGAGAAAGCACAACTCTCAACACCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014359    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032503.1-443s1c1
Sequence:CCGGCCCTGGATACTTGTAACCAATCTCGAGATTGGTTACAAGTATCCAGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)