EMAIL THIS PAGE TO A FRIEND

MCIDAS

multiciliate differentiation and DNA synthesis associated cell cycle protein

69 Gene Product Result for
Synonyms: IDAS MCI MCIN
UniProtKB ID: D6RGH6, C9JGY3, D6R920, F8KGQ8
Gene ID:
Mouse(622408) multiciliate differentiation and DNA synthesis associated cell cycle protein
Rat(688802) multiciliate differentiation and DNA synthesis associated cell cycle protein
chicken(101665139) multiciliate differentiation and DNA synthesis associated cell cycle protein
chicken(101747705) multiciliate differentiation and DNA synthesis associated cell cycle protein
cow(100301340) multiciliate cell differentiation 1
naked mole-rat(101725901) multiciliate differentiation and DNA synthesis associated cell cycle protein
domestic guinea pig(100735650) multiciliate differentiation and DNA synthesis associated cell cycle protein
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001037914 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001037914 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001037914 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XM_293918 Rosetta Predictions human pricing
XR_040410 Rosetta Predictions human pricing
XR_040411 Rosetta Predictions human pricing
XR_040412 Rosetta Predictions human pricing
XM_001068366 Rosetta Predictions rat pricing
NM_001037914 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_293918 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00277402 predicted 1814
2 SASI_Hs01_00277403 predicted 1584
3 SASI_Hs01_00277404 predicted 1613
4 SASI_Hs01_00277405 predicted 1738
5 SASI_Hs01_00277406 predicted 1780
6 SASI_Hs01_00277407 predicted 1748
7 SASI_Hs01_00277408 predicted 1701
8 SASI_Hs01_00277409 predicted 1545
9 SASI_Hs01_00277410 predicted 764
10 SASI_Hs01_00277411 predicted 1505
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_040410 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00518601 predicted 1552
2 SASI_Hs02_00518602 predicted 1397
3 SASI_Hs02_00518603 predicted 1105
4 SASI_Hs02_00518604 predicted 2228
5 SASI_Hs02_00518605 predicted 1118
6 SASI_Hs02_00518606 predicted 1173
7 SASI_Hs02_00518607 predicted 1791
8 SASI_Hs02_00518608 predicted 2158
9 SASI_Hs02_00518609 predicted 2194
10 SASI_Hs02_00518610 predicted 2122
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_040411 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00518611 predicted 1551
2 SASI_Hs02_00518612 predicted 1395
3 SASI_Hs02_00518613 predicted 1113
4 SASI_Hs02_00518614 predicted 2227
5 SASI_Hs02_00518615 predicted 1125
6 SASI_Hs02_00518616 predicted 1172
7 SASI_Hs02_00518617 predicted 1786
8 SASI_Hs02_00518618 predicted 2157
9 SASI_Hs02_00518619 predicted 2200
10 SASI_Hs02_00518620 predicted 2116
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_040412 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00518621 predicted 1551
2 SASI_Hs02_00518622 predicted 1396
3 SASI_Hs02_00518623 predicted 1110
4 SASI_Hs02_00518624 predicted 2225
5 SASI_Hs02_00518625 predicted 1122
6 SASI_Hs02_00518626 predicted 1166
7 SASI_Hs02_00518627 predicted 1784
8 SASI_Hs02_00518628 predicted 2159
9 SASI_Hs02_00518629 predicted 2193
10 SASI_Hs02_00518630 predicted 2118
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001068366 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00324302 predicted 449
2 SASI_Rn02_00324303 predicted 463
3 SASI_Rn02_00324304 predicted 500
4 SASI_Rn02_00324305 predicted 458
5 SASI_Rn02_00324306 predicted 439
6 SASI_Rn02_00324307 predicted 1084
7 SASI_Rn02_00324308 predicted 773
8 SASI_Rn02_00324309 predicted 526
9 SASI_Rn02_00324310 predicted 581
10 SASI_Rn02_00324311 predicted 527
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001037914 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00289503 predicted 411
2 SASI_Mm02_00289504 predicted 1506
3 SASI_Mm02_00289505 predicted 351
4 SASI_Mm02_00289506 predicted 644
5 SASI_Mm02_00289507 predicted 313
6 SASI_Mm02_00289508 predicted 645
7 SASI_Mm02_00289509 predicted 1507
8 SASI_Mm02_00289510 predicted 343
9 SASI_Mm02_00289511 predicted 211
10 SASI_Mm02_00289512 predicted 352
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001037914
MCIDAS MISSION shRNA Bacterial Glycerol Stock
multiciliate differentiation and DNA synthesis associated cell cycle protein
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000284429    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001037914.3-1379s21c1
Sequence:CCGGCACGGTGAAATTGCGTGTATACTCGAGTATACACGCAATTTCACCGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000270601    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037914.3-573s21c1
Sequence:CCGGGGACTGCTCTCATAGAGAATACTCGAGTATTCTCTATGAGAGCAGTCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000284434    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037914.3-1104s21c1
Sequence:CCGGCAGTCACCGGTGGTTACAAATCTCGAGATTTGTAACCACCGGTGACTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000270600    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037914.3-437s21c1
Sequence:CCGGCCTTGTGATGTTTCGTCTTTCCTCGAGGAAAGACGAAACATCACAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000270663    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037914.3-367s21c1
Sequence:CCGGGGATGACCTCATTGCAGATTCCTCGAGGAATCTGCAATGAGGTCATCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001037914
MCIDAS MISSION shRNA shRNA Plasmid DNA
multiciliate differentiation and DNA synthesis associated cell cycle protein
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000284429    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001037914.3-1379s21c1
Sequence:CCGGCACGGTGAAATTGCGTGTATACTCGAGTATACACGCAATTTCACCGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000270601    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037914.3-573s21c1
Sequence:CCGGGGACTGCTCTCATAGAGAATACTCGAGTATTCTCTATGAGAGCAGTCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000284434    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037914.3-1104s21c1
Sequence:CCGGCAGTCACCGGTGGTTACAAATCTCGAGATTTGTAACCACCGGTGACTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000270600    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037914.3-437s21c1
Sequence:CCGGCCTTGTGATGTTTCGTCTTTCCTCGAGGAAAGACGAAACATCACAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000270663    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037914.3-367s21c1
Sequence:CCGGGGATGACCTCATTGCAGATTCCTCGAGGAATCTGCAATGAGGTCATCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001037914
MCIDAS MISSION shRNA Lentiviral Transduction Particles
multiciliate differentiation and DNA synthesis associated cell cycle protein
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000284429    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001037914.3-1379s21c1
Sequence:CCGGCACGGTGAAATTGCGTGTATACTCGAGTATACACGCAATTTCACCGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000270601    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037914.3-573s21c1
Sequence:CCGGGGACTGCTCTCATAGAGAATACTCGAGTATTCTCTATGAGAGCAGTCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000284434    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037914.3-1104s21c1
Sequence:CCGGCAGTCACCGGTGGTTACAAATCTCGAGATTTGTAACCACCGGTGACTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000270600    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037914.3-437s21c1
Sequence:CCGGCCTTGTGATGTTTCGTCTTTCCTCGAGGAAAGACGAAACATCACAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000270663    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037914.3-367s21c1
Sequence:CCGGGGATGACCTCATTGCAGATTCCTCGAGGAATCTGCAATGAGGTCATCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)