EMAIL THIS PAGE TO A FRIEND

MCL1

myeloid cell leukemia sequence 1 (BCL2-related)

213 Gene Product Result for
Synonyms: BCL2L3 EAT MCL1-ES MCL1L MCL1S Mcl-1 TM bcl2-L-3 mcl1/EAT
Gene ID:
Human(4170) Summary: This gene encodes an anti-apoptotic protein, which is a member of the Bcl-2 family. Alternative splicing results in multiple transcript variants. The longest gene product (isoform 1) enhances cell survival by inhibiting apoptosis while the alternatively spliced shorter gene products (isoform 2 and isoform 3) promote apoptosis and are death-inducing. [provided by RefSeq, Oct 2010]
Mouse(17210) myeloid cell leukemia sequence 1
Rat(60430) myeloid cell leukemia sequence 1
sheep(554329) myeloid cell leukemia sequence 1 (BCL2-related)
domestic guinea pig(100721658) myeloid cell leukemia sequence 1 (BCL2-related)
naked mole-rat(101724340) myeloid cell leukemia sequence 1 (BCL2-related)
chicken(395674) myeloid cell leukemia sequence 1 (BCL2-related)
dog(403537) myeloid cell leukemia sequence 1 (BCL2-related)
domestic cat(493970) myeloid cell leukemia sequence 1 (BCL2-related)
cow(788087) myeloid cell leukemia sequence 1 (BCL2-related)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB3500291 Anti-Mcl-1 antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution mouse, rat, human
ELISA, immunocytochemistry, immunofluorescence, western blot pricing
SAB1105810 Anti-MCL1 (186-200) antibody produced in rabbit IgG fraction of antiserum human
western blot pricing
SAB2500623 Anti-MCL1 (Isoform 1) antibody produced in goat affinity isolated antibody, buffered aqueous solution human
ELISA, western blot pricing
HPA008455 Anti-MCL1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing
HPA031125 Anti-MCL1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing
SAB4501843 Anti-MCL1 antibody produced in rabbit affinity isolated antibody human, mouse
ELISA, western blot pricing
SAB4501844 Anti-MCL1 antibody produced in rabbit affinity isolated antibody rat, mouse, human
ELISA, immunohistochemistry, western blot pricing
SAB4504259 Anti-phospho-MCL1 (pSer159) antibody produced in rabbit affinity isolated antibody human, rat, mouse
ELISA, immunofluorescence pricing
AMAB90859 Monoclonal Anti-MCL1 antibody produced in mouse Prestige Antibodies® Powered by Atlas Antibodies, clone CL1128, purified immunoglobulin, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing
SAB5300052 Monoclonal Anti-MCL1 antibody produced in mouse clone 8C6, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing

Small Molecule - Antagonist

Product # Description Species Add to Cart
 
G8761 (±)-Gossypol from cotton seeds ≥95% (HPLC) human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_008562 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008562 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008562 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_021960 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_021960 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_021960 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_021960 Rosetta Predictions human pricing
NM_182763 Rosetta Predictions human pricing
NM_021846 Rosetta Predictions rat pricing
NM_008562 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021960 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00162656 predicted 1612
2 SASI_Hs01_00162657 predicted 1559
3 SASI_Hs01_00162658 predicted 1529
4 SASI_Hs01_00162659 predicted 1542
5 SASI_Hs01_00162660 predicted 1623
6 SASI_Hs01_00162661 predicted 1670
7 SASI_Hs01_00162662 predicted 1522
8 SASI_Hs01_00162663 predicted 1479
9 SASI_Hs02_00355300 predicted 1277
10 SASI_Hs01_00162665 predicted 1383
11 SASI_Hs01_00162664 predicted 1477
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_182763 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00223433 predicted 1367
2 SASI_Hs01_00223434 predicted 1313
3 SASI_Hs01_00223435 predicted 1278
4 SASI_Hs01_00223436 predicted 1296
5 SASI_Hs01_00223437 predicted 1381
6 SASI_Hs01_00223438 predicted 1432
7 SASI_Hs01_00223439 predicted 1419
8 SASI_Hs02_00370927 predicted 1272
9 SASI_Hs01_00223440 predicted 1232
10 SASI_Hs01_00223442 predicted 1138
11 SASI_Hs01_00223441 predicted 1228
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021846 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00262861 predicted 850
2 SASI_Rn02_00262862 predicted 862
3 SASI_Rn01_00094400 predicted 1156
4 SASI_Rn01_00094401 predicted 1244
5 SASI_Rn01_00094402 predicted 1094
6 SASI_Rn02_00262863 predicted 976
7 SASI_Rn02_00262864 predicted 972
8 SASI_Rn02_00262865 predicted 860
9 SASI_Rn01_00094404 predicted 1323
10 SASI_Rn01_00094405 predicted 1294
11 SASI_Rn01_00094403 predicted 1205
12 SASI_Rn01_00094406 predicted 1194
13 SASI_Rn01_00094407 predicted 1107
14 SASI_Rn01_00094408 predicted 1263
15 SASI_Rn01_00094409 predicted 1103
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008562 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00048593 predicted 1041
2 SASI_Mm02_00314161 predicted 1424
3 SASI_Mm01_00048594 predicted 924
4 SASI_Mm01_00048595 predicted 1242
5 SASI_Mm01_00048597 predicted 1214
6 SASI_Mm01_00048598 predicted 812
7 SASI_Mm01_00048600 predicted 866
8 SASI_Mm02_00314162 predicted 1193
9 SASI_Mm01_00048601 predicted 952
10 SASI_Mm01_00048602 predicted 1061
11 SASI_Mm01_00048596 predicted 1228
12 SASI_Mm01_00048599 predicted 552
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008562
VALIDATED
MCL1 MISSION shRNA Bacterial Glycerol Stock
myeloid cell leukemia sequence 1 (BCL2-related)
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000350585    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008562.3-1477s21c1
Sequence:CCGGCTAGTCACAAAGCTCAATAAACTCGAGTTTATTGAGCTTTGTGACTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273714    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008562.3-929s21c1
Sequence:CCGGGAAAGCTTCATCGAACCATTACTCGAGTAATGGTTCGATGAAGCTTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273761    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008562.3-796s21c1
Sequence:CCGGCGAAGGCGATGTTAAATCTTTCTCGAGAAAGATTTAACATCGCCTTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273762    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008562.3-864s21c1
Sequence:CCGGGCAGGATTGTGACTCTTATTTCTCGAGAAATAAGAGTCACAATCCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273764    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008562.3-773s21c1
Sequence:CCGGCTCCGGAAACTGGACATTAAACTCGAGTTTAATGTCCAGTTTCCGGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000004693    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008562.2-803s1c1
Sequence:CCGGGCAGGATTGTGACTCTTATTTCTCGAGAAATAAGAGTCACAATCCTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000004694    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008562.2-1049s1c1
Sequence:CCGGGTCTGGCATATCTAATAAGATCTCGAGATCTTATTAGATATGCCAGACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000004695    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008562.2-735s1c1
Sequence:CCGGCGAAGGCGATGTTAAATCTTTCTCGAGAAAGATTTAACATCGCCTTCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000004692    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008562.2-842s1c1
Sequence:CCGGCCAAACACTTAAAGAGCGTAACTCGAGTTACGCTCTTTAAGTGTTTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000004691    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008562.2-2992s1c1
Sequence:CCGGCCAGCTCACAAAGGGTGAAATCTCGAGATTTCACCCTTTGTGAGCTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008562
VALIDATED
MCL1 MISSION shRNA shRNA Plasmid DNA
myeloid cell leukemia sequence 1 (BCL2-related)
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000350585    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008562.3-1477s21c1
Sequence:CCGGCTAGTCACAAAGCTCAATAAACTCGAGTTTATTGAGCTTTGTGACTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000273714    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008562.3-929s21c1
Sequence:CCGGGAAAGCTTCATCGAACCATTACTCGAGTAATGGTTCGATGAAGCTTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000273761    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008562.3-796s21c1
Sequence:CCGGCGAAGGCGATGTTAAATCTTTCTCGAGAAAGATTTAACATCGCCTTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000273762    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008562.3-864s21c1
Sequence:CCGGGCAGGATTGTGACTCTTATTTCTCGAGAAATAAGAGTCACAATCCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000273764    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008562.3-773s21c1
Sequence:CCGGCTCCGGAAACTGGACATTAAACTCGAGTTTAATGTCCAGTTTCCGGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000004693    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008562.2-803s1c1
Sequence:CCGGGCAGGATTGTGACTCTTATTTCTCGAGAAATAAGAGTCACAATCCTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000004694    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008562.2-1049s1c1
Sequence:CCGGGTCTGGCATATCTAATAAGATCTCGAGATCTTATTAGATATGCCAGACTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000004695    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008562.2-735s1c1
Sequence:CCGGCGAAGGCGATGTTAAATCTTTCTCGAGAAAGATTTAACATCGCCTTCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000004692    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008562.2-842s1c1
Sequence:CCGGCCAAACACTTAAAGAGCGTAACTCGAGTTACGCTCTTTAAGTGTTTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000004691    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008562.2-2992s1c1
Sequence:CCGGCCAGCTCACAAAGGGTGAAATCTCGAGATTTCACCCTTTGTGAGCTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008562
VALIDATED
MCL1 MISSION shRNA Lentiviral Transduction Particles
myeloid cell leukemia sequence 1 (BCL2-related)
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000350585    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008562.3-1477s21c1
Sequence:CCGGCTAGTCACAAAGCTCAATAAACTCGAGTTTATTGAGCTTTGTGACTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273714    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008562.3-929s21c1
Sequence:CCGGGAAAGCTTCATCGAACCATTACTCGAGTAATGGTTCGATGAAGCTTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273761    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008562.3-796s21c1
Sequence:CCGGCGAAGGCGATGTTAAATCTTTCTCGAGAAAGATTTAACATCGCCTTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273762    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008562.3-864s21c1
Sequence:CCGGGCAGGATTGTGACTCTTATTTCTCGAGAAATAAGAGTCACAATCCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273764    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008562.3-773s21c1
Sequence:CCGGCTCCGGAAACTGGACATTAAACTCGAGTTTAATGTCCAGTTTCCGGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000004693    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008562.2-803s1c1
Sequence:CCGGGCAGGATTGTGACTCTTATTTCTCGAGAAATAAGAGTCACAATCCTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000004694    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008562.2-1049s1c1
Sequence:CCGGGTCTGGCATATCTAATAAGATCTCGAGATCTTATTAGATATGCCAGACTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000004695    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008562.2-735s1c1
Sequence:CCGGCGAAGGCGATGTTAAATCTTTCTCGAGAAAGATTTAACATCGCCTTCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000004692    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008562.2-842s1c1
Sequence:CCGGCCAAACACTTAAAGAGCGTAACTCGAGTTACGCTCTTTAAGTGTTTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000004691    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008562.2-2992s1c1
Sequence:CCGGCCAGCTCACAAAGGGTGAAATCTCGAGATTTCACCCTTTGTGAGCTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021960
MCL1 MISSION shRNA Bacterial Glycerol Stock
myeloid cell leukemia sequence 1 (BCL2-related)
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000005514    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021960.3-3125s1c1
Sequence:CCGGGCTGTGTTAAACCTCAGAGTTCTCGAGAACTCTGAGGTTTAACACAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005518    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021960.3-823s1c1
Sequence:CCGGGCTTCGGAAACTGGACATCAACTCGAGTTGATGTCCAGTTTCCGAAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005517    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021960.3-953s1c1
Sequence:CCGGGCTAAACACTTGAAGACCATACTCGAGTATGGTCTTCAAGTGTTTAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005516    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021960.3-664s1c1
Sequence:CCGGGCTGGAGATTATCTCTCGGTACTCGAGTACCGAGAGATAATCTCCAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199377    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021960.3-447s1c1
Sequence:CCGGCGCCGCTTGAGGAGATGGAAGCTCGAGCTTCCATCTCCTCAAGCGGCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199070    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021960.3-481s1c1
Sequence:CCGGCGCCATCATGTCGCCCGAAGACTCGAGTCTTCGGGCGACATGATGGCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195684    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021960.3-847s1c1
Sequence:CCGGCGAAGACGATGTGAAATCGTTCTCGAGAACGATTTCACATCGTCTTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196390    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021960.3-1773s1c1
Sequence:CCGGGCCTAGTTTATCACCAATAATCTCGAGATTATTGGTGATAAACTAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196914    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021960.3-915s1c1
Sequence:CCGGGCAGGATTGTGACTCTCATTTCTCGAGAAATGAGAGTCACAATCCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197024    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021960.3-1155s1c1
Sequence:CCGGGAGCTGGTTTGGCATATCTAACTCGAGTTAGATATGCCAAACCAGCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195446    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021960.3-1084s1c1
Sequence:CCGGCTTCCATGTAGAGGACCTAGACTCGAGTCTAGGTCCTCTACATGGAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194663    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021960.3-2092s1c1
Sequence:CCGGCTGATAACTATGCAGGTTTAACTCGAGTTAAACCTGCATAGTTATCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021960
MCL1 MISSION shRNA shRNA Plasmid DNA
myeloid cell leukemia sequence 1 (BCL2-related)
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000005514    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021960.3-3125s1c1
Sequence:CCGGGCTGTGTTAAACCTCAGAGTTCTCGAGAACTCTGAGGTTTAACACAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005518    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021960.3-823s1c1
Sequence:CCGGGCTTCGGAAACTGGACATCAACTCGAGTTGATGTCCAGTTTCCGAAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005517    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021960.3-953s1c1
Sequence:CCGGGCTAAACACTTGAAGACCATACTCGAGTATGGTCTTCAAGTGTTTAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005516    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021960.3-664s1c1
Sequence:CCGGGCTGGAGATTATCTCTCGGTACTCGAGTACCGAGAGATAATCTCCAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199377    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021960.3-447s1c1
Sequence:CCGGCGCCGCTTGAGGAGATGGAAGCTCGAGCTTCCATCTCCTCAAGCGGCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199070    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021960.3-481s1c1
Sequence:CCGGCGCCATCATGTCGCCCGAAGACTCGAGTCTTCGGGCGACATGATGGCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195684    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021960.3-847s1c1
Sequence:CCGGCGAAGACGATGTGAAATCGTTCTCGAGAACGATTTCACATCGTCTTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000196390    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021960.3-1773s1c1
Sequence:CCGGGCCTAGTTTATCACCAATAATCTCGAGATTATTGGTGATAAACTAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000196914    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021960.3-915s1c1
Sequence:CCGGGCAGGATTGTGACTCTCATTTCTCGAGAAATGAGAGTCACAATCCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000197024    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021960.3-1155s1c1
Sequence:CCGGGAGCTGGTTTGGCATATCTAACTCGAGTTAGATATGCCAAACCAGCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195446    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021960.3-1084s1c1
Sequence:CCGGCTTCCATGTAGAGGACCTAGACTCGAGTCTAGGTCCTCTACATGGAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000194663    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021960.3-2092s1c1
Sequence:CCGGCTGATAACTATGCAGGTTTAACTCGAGTTAAACCTGCATAGTTATCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021960
MCL1 MISSION shRNA Lentiviral Transduction Particles
myeloid cell leukemia sequence 1 (BCL2-related)
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000005514    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021960.3-3125s1c1
Sequence:CCGGGCTGTGTTAAACCTCAGAGTTCTCGAGAACTCTGAGGTTTAACACAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005518    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021960.3-823s1c1
Sequence:CCGGGCTTCGGAAACTGGACATCAACTCGAGTTGATGTCCAGTTTCCGAAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005517    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021960.3-953s1c1
Sequence:CCGGGCTAAACACTTGAAGACCATACTCGAGTATGGTCTTCAAGTGTTTAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005516    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021960.3-664s1c1
Sequence:CCGGGCTGGAGATTATCTCTCGGTACTCGAGTACCGAGAGATAATCTCCAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199377    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021960.3-447s1c1
Sequence:CCGGCGCCGCTTGAGGAGATGGAAGCTCGAGCTTCCATCTCCTCAAGCGGCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199070    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021960.3-481s1c1
Sequence:CCGGCGCCATCATGTCGCCCGAAGACTCGAGTCTTCGGGCGACATGATGGCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195684    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021960.3-847s1c1
Sequence:CCGGCGAAGACGATGTGAAATCGTTCTCGAGAACGATTTCACATCGTCTTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196390    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021960.3-1773s1c1
Sequence:CCGGGCCTAGTTTATCACCAATAATCTCGAGATTATTGGTGATAAACTAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196914    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021960.3-915s1c1
Sequence:CCGGGCAGGATTGTGACTCTCATTTCTCGAGAAATGAGAGTCACAATCCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197024    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021960.3-1155s1c1
Sequence:CCGGGAGCTGGTTTGGCATATCTAACTCGAGTTAGATATGCCAAACCAGCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195446    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021960.3-1084s1c1
Sequence:CCGGCTTCCATGTAGAGGACCTAGACTCGAGTCTAGGTCCTCTACATGGAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194663    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021960.3-2092s1c1
Sequence:CCGGCTGATAACTATGCAGGTTTAACTCGAGTTAAACCTGCATAGTTATCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)