EMAIL THIS PAGE TO A FRIEND

MCM10

minichromosome maintenance complex component 10

63 Gene Product Result for
Synonyms: CNA43 DNA43
Gene ID:
Human(55388) Summary: The protein encoded by this gene is one of the highly conserved mini-chromosome maintenance proteins (MCM) that are involved in the initiation of eukaryotic genome replication. The hexameric protein complex formed by MCM proteins is a key component of the pre-replication complex (pre-RC) and it may be involved in the formation of replication forks and in the recruitment of other DNA replication related proteins. This protein can interact with MCM2 and MCM6, as well as with the origin recognition protein ORC2. It is regulated by proteolysis and phosphorylation in a cell cycle-dependent manner. Studies of a similar protein in Xenopus suggest that the chromatin binding of this protein at the onset of DNA replication is after pre-RC assembly and before origin unwinding. Alternatively spliced transcript variants encoding distinct isoforms have been identified. [provided by RefSeq, Jul 2008]
Mouse(70024) minichromosome maintenance deficient 10 (S. cerevisiae)
Rat(307126) minichromosome maintenance complex component 10
Zebrafish(553396) minichromosome maintenance complex component 10
fruit fly(35390) Sensitized chromosome inheritance modifier 19
cow(527595) minichromosome maintenance complex component 10
Horse(100069273) minichromosome maintenance complex component 10
domestic cat(101097738) minichromosome maintenance complex component 10
dog(487128) minichromosome maintenance complex component 10
chicken(429525) minichromosome maintenance complex component 10
Thale Cress(816632) minichromosome maintenance protein 10
sheep(101106958) minichromosome maintenance complex component 10
naked mole-rat(101725983) minichromosome maintenance complex component 10
Domestic Rabbit(100343921) minichromosome maintenance complex component 10
domestic guinea pig(100724190) minichromosome maintenance complex component 10
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_027290 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027290 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027290 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_182751 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_182751 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_182751 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018518 Rosetta Predictions human pricing
NM_182751 Rosetta Predictions human pricing
NM_001107366 Rosetta Predictions rat pricing
NM_027290 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018518 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00170185 predicted 1050
2 SASI_Hs01_00170187 predicted 748
3 SASI_Hs01_00170188 predicted 872
4 SASI_Hs02_00352092 predicted 214
5 SASI_Hs01_00170189 predicted 1075
6 SASI_Hs01_00170190 predicted 1841
7 SASI_Hs01_00170191 predicted 2346
8 SASI_Hs01_00170192 predicted 1193
9 SASI_Hs01_00170193 predicted 2499
10 SASI_Hs01_00170194 predicted 2787
11 SASI_Hs01_00170186 predicted 968
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_182751 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00045054 predicted 1047
2 SASI_Hs01_00045056 predicted 759
3 SASI_Hs01_00045057 predicted 868
4 SASI_Hs02_00370910 predicted 218
5 SASI_Hs01_00045058 predicted 1079
6 SASI_Hs01_00045059 predicted 1846
7 SASI_Hs01_00045060 predicted 2349
8 SASI_Hs01_00045061 predicted 1200
9 SASI_Hs01_00045062 predicted 2497
10 SASI_Hs01_00045063 predicted 2786
11 SASI_Hs01_00045055 predicted 970
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107366 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00228115 predicted 1404
2 SASI_Rn02_00228116 predicted 453
3 SASI_Rn02_00228117 predicted 2869
4 SASI_Rn02_00228118 predicted 1606
5 SASI_Rn02_00228119 predicted 518
6 SASI_Rn02_00228120 predicted 1283
7 SASI_Rn02_00228121 predicted 982
8 SASI_Rn02_00228122 predicted 1051
9 SASI_Rn02_00228123 predicted 2651
10 SASI_Rn02_00228124 predicted 2883
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027290 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00155747 predicted 1348
2 SASI_Mm01_00155748 predicted 1044
3 SASI_Mm01_00155749 predicted 2624
4 SASI_Mm01_00155750 predicted 2309
5 SASI_Mm01_00155751 predicted 1432
6 SASI_Mm01_00155752 predicted 2851
7 SASI_Mm01_00155753 predicted 2631
8 SASI_Mm01_00155754 predicted 1258
9 SASI_Mm01_00155755 predicted 957
10 SASI_Mm01_00155756 predicted 1382
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027290
VALIDATED
MCM10 MISSION shRNA Bacterial Glycerol Stock
minichromosome maintenance complex component 10
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000201477    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027290.1-2313s1c1
Sequence:CCGGCCTACTTAGAGTCCGAGGAATCTCGAGATTCCTCGGACTCTAAGTAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241185    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_027290.2-1085s21c1
Sequence:CCGGCTACCAGTGGGCAAACGTTTACTCGAGTAAACGTTTGCCCACTGGTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241187    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_027290.2-2314s21c1
Sequence:CCGGTACTTAGAGTCCGAGGAATTTCTCGAGAAATTCCTCGGACTCTAAGTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217557    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027290.2-1353s1c1
Sequence:CCGGGCCATGTACACAGACAGTTAACTCGAGTTAACTGTCTGTGTACATGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241189    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_027290.2-256s21c1
Sequence:CCGGGATGGTGATGGTGAGTCTTACCTCGAGGTAAGACTCACCATCACCATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241188    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027290.2-2911s21c1
Sequence:CCGGTGCTGGCCTGACACCATATTTCTCGAGAAATATGGTGTCAGGCCAGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241186    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027290.2-1441s21c1
Sequence:CCGGACTGATCTGCAGTCCACTTTCCTCGAGGAAAGTGGACTGCAGATCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027290
VALIDATED
MCM10 MISSION shRNA shRNA Plasmid DNA
minichromosome maintenance complex component 10
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000201477    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027290.1-2313s1c1
Sequence:CCGGCCTACTTAGAGTCCGAGGAATCTCGAGATTCCTCGGACTCTAAGTAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000241185    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_027290.2-1085s21c1
Sequence:CCGGCTACCAGTGGGCAAACGTTTACTCGAGTAAACGTTTGCCCACTGGTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000241187    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_027290.2-2314s21c1
Sequence:CCGGTACTTAGAGTCCGAGGAATTTCTCGAGAAATTCCTCGGACTCTAAGTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000217557    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027290.2-1353s1c1
Sequence:CCGGGCCATGTACACAGACAGTTAACTCGAGTTAACTGTCTGTGTACATGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000241189    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_027290.2-256s21c1
Sequence:CCGGGATGGTGATGGTGAGTCTTACCTCGAGGTAAGACTCACCATCACCATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000241188    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027290.2-2911s21c1
Sequence:CCGGTGCTGGCCTGACACCATATTTCTCGAGAAATATGGTGTCAGGCCAGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000241186    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027290.2-1441s21c1
Sequence:CCGGACTGATCTGCAGTCCACTTTCCTCGAGGAAAGTGGACTGCAGATCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027290
VALIDATED
MCM10 MISSION shRNA Lentiviral Transduction Particles
minichromosome maintenance complex component 10
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000201477    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027290.1-2313s1c1
Sequence:CCGGCCTACTTAGAGTCCGAGGAATCTCGAGATTCCTCGGACTCTAAGTAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241185    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_027290.2-1085s21c1
Sequence:CCGGCTACCAGTGGGCAAACGTTTACTCGAGTAAACGTTTGCCCACTGGTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241187    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_027290.2-2314s21c1
Sequence:CCGGTACTTAGAGTCCGAGGAATTTCTCGAGAAATTCCTCGGACTCTAAGTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217557    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027290.2-1353s1c1
Sequence:CCGGGCCATGTACACAGACAGTTAACTCGAGTTAACTGTCTGTGTACATGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241189    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_027290.2-256s21c1
Sequence:CCGGGATGGTGATGGTGAGTCTTACCTCGAGGTAAGACTCACCATCACCATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241188    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027290.2-2911s21c1
Sequence:CCGGTGCTGGCCTGACACCATATTTCTCGAGAAATATGGTGTCAGGCCAGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241186    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027290.2-1441s21c1
Sequence:CCGGACTGATCTGCAGTCCACTTTCCTCGAGGAAAGTGGACTGCAGATCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_182751
VALIDATED
MCM10 MISSION shRNA Bacterial Glycerol Stock
minichromosome maintenance complex component 10
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000168342    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182751.1-2703s1c1
Sequence:CCGGGCTAAATTTCTGAACAGCCTTCTCGAGAAGGCTGTTCAGAAATTTAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168198    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_182751.1-3358s1c1
Sequence:CCGGCCACTGAATCACTTTGCATTTCTCGAGAAATGCAAAGTGATTCAGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167692    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_182751.1-3301s1c1
Sequence:CCGGGCCAGATTTCTTCATTCAATTCTCGAGAATTGAATGAAGAAATCTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245424    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_182751.1-4097s21c1
Sequence:CCGGCCTAAGGTTATGTCCTAATAACTCGAGTTATTAGGACATAACCTTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245427    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_182751.1-2353s21c1
Sequence:CCGGAGATGCAGGAGCGCTACTTTGCTCGAGCAAAGTAGCGCTCCTGCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245428    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_182751.1-774s21c1
Sequence:CCGGGGGATAACTAGAGGTCAAATTCTCGAGAATTTGACCTCTAGTTATCCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245426    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182751.1-246s21c1
Sequence:CCGGGACGGCGACGGTGAATCTTATCTCGAGATAAGATTCACCGTCGCCGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245425    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_182751.1-1220s21c1
Sequence:CCGGTCATCCTCAGAAGGTCTTAATCTCGAGATTAAGACCTTCTGAGGATGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_182751
VALIDATED
MCM10 MISSION shRNA shRNA Plasmid DNA
minichromosome maintenance complex component 10
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000168342    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182751.1-2703s1c1
Sequence:CCGGGCTAAATTTCTGAACAGCCTTCTCGAGAAGGCTGTTCAGAAATTTAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000168198    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_182751.1-3358s1c1
Sequence:CCGGCCACTGAATCACTTTGCATTTCTCGAGAAATGCAAAGTGATTCAGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000167692    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_182751.1-3301s1c1
Sequence:CCGGGCCAGATTTCTTCATTCAATTCTCGAGAATTGAATGAAGAAATCTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000245424    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_182751.1-4097s21c1
Sequence:CCGGCCTAAGGTTATGTCCTAATAACTCGAGTTATTAGGACATAACCTTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000245427    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_182751.1-2353s21c1
Sequence:CCGGAGATGCAGGAGCGCTACTTTGCTCGAGCAAAGTAGCGCTCCTGCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000245428    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_182751.1-774s21c1
Sequence:CCGGGGGATAACTAGAGGTCAAATTCTCGAGAATTTGACCTCTAGTTATCCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000245426    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182751.1-246s21c1
Sequence:CCGGGACGGCGACGGTGAATCTTATCTCGAGATAAGATTCACCGTCGCCGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000245425    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_182751.1-1220s21c1
Sequence:CCGGTCATCCTCAGAAGGTCTTAATCTCGAGATTAAGACCTTCTGAGGATGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_182751
VALIDATED
MCM10 MISSION shRNA Lentiviral Transduction Particles
minichromosome maintenance complex component 10
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000168342    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182751.1-2703s1c1
Sequence:CCGGGCTAAATTTCTGAACAGCCTTCTCGAGAAGGCTGTTCAGAAATTTAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168198    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_182751.1-3358s1c1
Sequence:CCGGCCACTGAATCACTTTGCATTTCTCGAGAAATGCAAAGTGATTCAGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167692    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_182751.1-3301s1c1
Sequence:CCGGGCCAGATTTCTTCATTCAATTCTCGAGAATTGAATGAAGAAATCTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245424    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_182751.1-4097s21c1
Sequence:CCGGCCTAAGGTTATGTCCTAATAACTCGAGTTATTAGGACATAACCTTAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245427    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_182751.1-2353s21c1
Sequence:CCGGAGATGCAGGAGCGCTACTTTGCTCGAGCAAAGTAGCGCTCCTGCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245428    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_182751.1-774s21c1
Sequence:CCGGGGGATAACTAGAGGTCAAATTCTCGAGAATTTGACCTCTAGTTATCCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245426    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182751.1-246s21c1
Sequence:CCGGGACGGCGACGGTGAATCTTATCTCGAGATAAGATTCACCGTCGCCGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245425    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_182751.1-1220s21c1
Sequence:CCGGTCATCCTCAGAAGGTCTTAATCTCGAGATTAAGACCTTCTGAGGATGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)