EMAIL THIS PAGE TO A FRIEND

MCM2

minichromosome maintenance complex component 2

68 Gene Product Result for
Synonyms: BM28 CCNL1 CDCL1 D3S3194 MITOTIN cdc19
Gene ID:
Human(4171) Summary: The protein encoded by this gene is one of the highly conserved mini-chromosome maintenance proteins (MCM) that are involved in the initiation of eukaryotic genome replication. The hexameric protein complex formed by MCM proteins is a key component of the pre-replication complex (pre_RC) and may be involved in the formation of replication forks and in the recruitment of other DNA replication related proteins. This protein forms a complex with MCM4, 6, and 7, and has been shown to regulate the helicase activity of the complex. This protein is phosphorylated, and thus regulated by, protein kinases CDC2 and CDC7. Multiple alternatively spliced transcript variants have been found, but the full-length nature of some variants has not been defined. [provided by RefSeq, Oct 2012]
Mouse(17216) minichromosome maintenance deficient 2 mitotin (S. cerevisiae)
Rat(312538) minichromosome maintenance complex component 2
domestic guinea pig(100722936) minichromosome maintenance complex component 2
naked mole-rat(101710978) minichromosome maintenance complex component 2
sheep(101116097) minichromosome maintenance complex component 2
Zebrafish(192338) MCM2 minichromosome maintenance deficient 2, mitotin (S. cerevisiae)
domestic cat(101090176) minichromosome maintenance complex component 2
dog(484622) minichromosome maintenance complex component 2
cow(510120) minichromosome maintenance complex component 2
chicken(416027) minichromosome maintenance complex component 2
Thale Cress(841056) minichromosome maintenance protein 2
fruit fly(40973) Minichromosome maintenance 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1100137 Anti-MCM2 (41-55) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
SAB1100138 Anti-MCM2 (501-515) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
AV36647 Anti-MCM2 antibody produced in rabbit IgG fraction of antiserum rabbit, horse, pig, human, bovine
western blot pricing
SAB2101444 Anti-MCM2 antibody produced in rabbit affinity isolated antibody horse, rabbit, rat, guinea pig, human, dog, bovine
western blot pricing
HPA031495 Anti-MCM2 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution Antibody Enhanced Validation human
immunofluorescence, immunohistochemistry, western blot pricing
HPA031496 Anti-MCM2 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution Antibody Enhanced Validation human
immunofluorescence, immunohistochemistry, western blot pricing
SAB4501845 Anti-MCM2 antibody produced in rabbit affinity isolated antibody human, mouse
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB5500142 Anti-MCM2 antibody, Rabbit monoclonal clone SP85, recombinant, expressed in proprietary host, affinity isolated antibody human (tested)
flow cytometry, immunohistochemistry, western blot pricing
PLA0037 Goat anti-MCM2 Antibody, Affinity Purified human, mouse
proximity ligation assay, western blot pricing
WH0004171M1 Monoclonal Anti-MCM2 antibody produced in mouse clone 6A8, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunoprecipitation (IP), western blot pricing
SAB5300251 Monoclonal Anti-MCM2 antibody produced in mouse clone 2B3, ascites fluid human, mouse, rat, monkey
ELISA, flow cytometry, immunohistochemistry, western blot pricing
SAB5300252 Monoclonal Anti-MCM2 antibody produced in mouse clone 1E7, ascites fluid human
ELISA, flow cytometry, immunofluorescence, immunohistochemistry, western blot pricing
PLA0060 Rabbit anti-MCM2 Antibody, Affinity Purified Powered by Bethyl Laboratories, Inc. human, mouse
immunohistochemistry, immunoprecipitation (IP), proximity ligation assay, western blot pricing
PLA0026 Rabbit anti-Phospho MCM2 (S108) Antibody, Affinity Purified mouse, human
immunohistochemistry, proximity ligation assay, western blot pricing
PLA0141 Rabbit anti-Phospho MCM2 (S40/S41) Antibody, Affinity Purified Powered by Bethyl Laboratories, Inc. human
flow cytometry, immunohistochemistry, proximity ligation assay, western blot pricing
PLA0034 Rabbit anti-Phospho MCM2 (S41) Antibody, Affinity Purified Powered by Bethyl Laboratories, Inc. mouse, human
immunohistochemistry, proximity ligation assay, western blot pricing
PLA0138 Rabbit anti-Phospho MCM2 (S53) Antibody, Affinity Purified Powered by Bethyl Laboratories, Inc. mouse, human
immunohistochemistry, proximity ligation assay, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_008564 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008564 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008564 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_004526 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004526 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004526 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004526 Rosetta Predictions human pricing
NM_001107873 Rosetta Predictions rat pricing
NM_008564 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004526 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00013911 predicted 1164
2 SASI_Hs01_00013912 predicted 1598
3 SASI_Hs01_00013913 predicted 1471
4 SASI_Hs01_00013914 predicted 2023
5 SASI_Hs01_00013915 predicted 1240
6 SASI_Hs01_00013916 predicted 1454
7 SASI_Hs01_00013917 predicted 2309
8 SASI_Hs01_00013918 predicted 1050
9 SASI_Hs02_00337822 predicted 2779
10 SASI_Hs01_00013919 predicted 2011
11 SASI_Hs01_00013910 predicted 1306
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107873 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00233125 predicted 441
2 SASI_Rn02_00233126 predicted 1642
3 SASI_Rn02_00233127 predicted 1631
4 SASI_Rn02_00233128 predicted 1546
5 SASI_Rn02_00233129 predicted 1280
6 SASI_Rn02_00233130 predicted 521
7 SASI_Rn02_00233131 predicted 2255
8 SASI_Rn02_00233132 predicted 1139
9 SASI_Rn02_00233133 predicted 1852
10 SASI_Rn02_00233134 predicted 2209
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008564 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00077195 predicted 1573
2 SASI_Mm01_00077196 predicted 1137
3 SASI_Mm01_00077197 predicted 1375
4 SASI_Mm01_00077198 predicted 1633
5 SASI_Mm01_00077199 predicted 1230
6 SASI_Mm01_00077200 predicted 931
7 SASI_Mm01_00077201 predicted 1544
8 SASI_Mm01_00077202 predicted 2705
9 SASI_Mm01_00077203 predicted 2287
10 SASI_Mm01_00077204 predicted 1541
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008564
VALIDATED
MCM2 MISSION shRNA Bacterial Glycerol Stock
minichromosome maintenance complex component 2
Mouse
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000375306    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008564.2-2073s21c1
Sequence:CCGGACCTCACAGAGCCCATCATTTCTCGAGAAATGATGGGCTCTGTGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000329231    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008564.2-1371s21c1
Sequence:CCGGTGACCGGCATTTACCATAATACTCGAGTATTATGGTAAATGCCGGTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000329157    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008564.2-1426s21c1
Sequence:CCGGTCCAGTCTTTGCCACTATTATCTCGAGATAATAGTGGCAAAGACTGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174336    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008564.1-1295s1c1
Sequence:CCGGCGGCATTTACCATAATAACTACTCGAGTAGTTATTATGGTAAATGCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193219    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008564.1-2657s1c1
Sequence:CCGGCAGGCAGATCAATATTCACAACTCGAGTTGTGAATATTGATCTGCCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194034    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008564.1-2123s1c1
Sequence:CCGGGAAGGATGAAGGGTTGACTAACTCGAGTTAGTCAACCCTTCATCCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216266    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008564.2-2993s1c1
Sequence:CCGGCTGTAGCATTAAATGACTATTCTCGAGAATAGTCATTTAATGCTACAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000329229    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008564.2-3165s21c1
Sequence:CCGGTTTAGACAAAGAGCAACTTAGCTCGAGCTAAGTTGCTCTTTGTCTAAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000329158    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008564.2-930s21c1
Sequence:CCGGTGTTGGCCATGTACCCTAAATCTCGAGATTTAGGGTACATGGCCAACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193473    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008564.1-1292s1c1
Sequence:CCGGGACCGGCATTTACCATAATAACTCGAGTTATTATGGTAAATGCCGGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193538    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008564.1-732s1c1
Sequence:CCGGGAGAGTTTGGTGGTAAATTATCTCGAGATAATTTACCACCAAACTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000375307    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008564.2-2552s21c1
Sequence:CCGGTTCAGCGTCATGCGGAGTATGCTCGAGCATACTCCGCATGACGCTGAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175036    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008564.1-860s1c1
Sequence:CCGGGTACCCTAAATATGACCGTATCTCGAGATACGGTCATATTTAGGGTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008564
VALIDATED
MCM2 MISSION shRNA shRNA Plasmid DNA
minichromosome maintenance complex component 2
Mouse
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000375306    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008564.2-2073s21c1
Sequence:CCGGACCTCACAGAGCCCATCATTTCTCGAGAAATGATGGGCTCTGTGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000329231    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008564.2-1371s21c1
Sequence:CCGGTGACCGGCATTTACCATAATACTCGAGTATTATGGTAAATGCCGGTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000329157    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008564.2-1426s21c1
Sequence:CCGGTCCAGTCTTTGCCACTATTATCTCGAGATAATAGTGGCAAAGACTGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000174336    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008564.1-1295s1c1
Sequence:CCGGCGGCATTTACCATAATAACTACTCGAGTAGTTATTATGGTAAATGCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000193219    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008564.1-2657s1c1
Sequence:CCGGCAGGCAGATCAATATTCACAACTCGAGTTGTGAATATTGATCTGCCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000194034    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008564.1-2123s1c1
Sequence:CCGGGAAGGATGAAGGGTTGACTAACTCGAGTTAGTCAACCCTTCATCCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000216266    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008564.2-2993s1c1
Sequence:CCGGCTGTAGCATTAAATGACTATTCTCGAGAATAGTCATTTAATGCTACAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000329229    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008564.2-3165s21c1
Sequence:CCGGTTTAGACAAAGAGCAACTTAGCTCGAGCTAAGTTGCTCTTTGTCTAAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000329158    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008564.2-930s21c1
Sequence:CCGGTGTTGGCCATGTACCCTAAATCTCGAGATTTAGGGTACATGGCCAACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000193473    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008564.1-1292s1c1
Sequence:CCGGGACCGGCATTTACCATAATAACTCGAGTTATTATGGTAAATGCCGGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000193538    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008564.1-732s1c1
Sequence:CCGGGAGAGTTTGGTGGTAAATTATCTCGAGATAATTTACCACCAAACTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000375307    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008564.2-2552s21c1
Sequence:CCGGTTCAGCGTCATGCGGAGTATGCTCGAGCATACTCCGCATGACGCTGAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000175036    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008564.1-860s1c1
Sequence:CCGGGTACCCTAAATATGACCGTATCTCGAGATACGGTCATATTTAGGGTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008564
VALIDATED
MCM2 MISSION shRNA Lentiviral Transduction Particles
minichromosome maintenance complex component 2
Mouse
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000375306    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008564.2-2073s21c1
Sequence:CCGGACCTCACAGAGCCCATCATTTCTCGAGAAATGATGGGCTCTGTGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000329231    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008564.2-1371s21c1
Sequence:CCGGTGACCGGCATTTACCATAATACTCGAGTATTATGGTAAATGCCGGTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000329157    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008564.2-1426s21c1
Sequence:CCGGTCCAGTCTTTGCCACTATTATCTCGAGATAATAGTGGCAAAGACTGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174336    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008564.1-1295s1c1
Sequence:CCGGCGGCATTTACCATAATAACTACTCGAGTAGTTATTATGGTAAATGCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193219    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008564.1-2657s1c1
Sequence:CCGGCAGGCAGATCAATATTCACAACTCGAGTTGTGAATATTGATCTGCCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194034    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008564.1-2123s1c1
Sequence:CCGGGAAGGATGAAGGGTTGACTAACTCGAGTTAGTCAACCCTTCATCCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216266    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008564.2-2993s1c1
Sequence:CCGGCTGTAGCATTAAATGACTATTCTCGAGAATAGTCATTTAATGCTACAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000329229    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008564.2-3165s21c1
Sequence:CCGGTTTAGACAAAGAGCAACTTAGCTCGAGCTAAGTTGCTCTTTGTCTAAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000329158    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008564.2-930s21c1
Sequence:CCGGTGTTGGCCATGTACCCTAAATCTCGAGATTTAGGGTACATGGCCAACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193473    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008564.1-1292s1c1
Sequence:CCGGGACCGGCATTTACCATAATAACTCGAGTTATTATGGTAAATGCCGGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193538    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008564.1-732s1c1
Sequence:CCGGGAGAGTTTGGTGGTAAATTATCTCGAGATAATTTACCACCAAACTCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000375307    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008564.2-2552s21c1
Sequence:CCGGTTCAGCGTCATGCGGAGTATGCTCGAGCATACTCCGCATGACGCTGAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175036    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008564.1-860s1c1
Sequence:CCGGGTACCCTAAATATGACCGTATCTCGAGATACGGTCATATTTAGGGTACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004526
VALIDATED
MCM2 MISSION shRNA Bacterial Glycerol Stock
minichromosome maintenance complex component 2
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000278372    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_004526.2-1164s21c1
Sequence:CCGGCTATCAGAACTACCAGCGTATCTCGAGATACGCTGGTAGTTCTGATAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278310    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_004526.2-2553s21c1
Sequence:CCGGGCTCTTCATACTGAAGCAGTTCTCGAGAACTGCTTCAGTATGAAGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278374    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 2 Clone ID:NM_004526.2-2392s21c1
Sequence:CCGGCGCATCCATCTGCGGGACTATCTCGAGATAGTCCCGCAGATGGATGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019509    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_004526.2-1587s1c1
Sequence:CCGGGCACAAGGTACGTGGTGATATCTCGAGATATCACCACGTACCTTGTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278309    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_004526.2-1587s21c1
Sequence:CCGGGCACAAGGTACGTGGTGATATCTCGAGATATCACCACGTACCTTGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278308    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004526.2-1798s21c1
Sequence:CCGGCGAGGAGTGTGTCTCATTGATCTCGAGATCAATGAGACACACTCCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019510    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_004526.2-1164s1c1
Sequence:CCGGCTATCAGAACTACCAGCGTATCTCGAGATACGCTGGTAGTTCTGATAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019511    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_004526.2-2392s1c1
Sequence:CCGGCGCATCCATCTGCGGGACTATCTCGAGATAGTCCCGCAGATGGATGCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019512    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_004526.2-1798s1c1
Sequence:CCGGCGAGGAGTGTGTCTCATTGATCTCGAGATCAATGAGACACACTCCTCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019513    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_004526.2-2553s1c1
Sequence:CCGGGCTCTTCATACTGAAGCAGTTCTCGAGAACTGCTTCAGTATGAAGAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004526
VALIDATED
MCM2 MISSION shRNA shRNA Plasmid DNA
minichromosome maintenance complex component 2
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000278372    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_004526.2-1164s21c1
Sequence:CCGGCTATCAGAACTACCAGCGTATCTCGAGATACGCTGGTAGTTCTGATAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000278310    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_004526.2-2553s21c1
Sequence:CCGGGCTCTTCATACTGAAGCAGTTCTCGAGAACTGCTTCAGTATGAAGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000278374    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 2 Clone ID:NM_004526.2-2392s21c1
Sequence:CCGGCGCATCCATCTGCGGGACTATCTCGAGATAGTCCCGCAGATGGATGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000019509    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_004526.2-1587s1c1
Sequence:CCGGGCACAAGGTACGTGGTGATATCTCGAGATATCACCACGTACCTTGTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000278309    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_004526.2-1587s21c1
Sequence:CCGGGCACAAGGTACGTGGTGATATCTCGAGATATCACCACGTACCTTGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000278308    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004526.2-1798s21c1
Sequence:CCGGCGAGGAGTGTGTCTCATTGATCTCGAGATCAATGAGACACACTCCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000019510    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_004526.2-1164s1c1
Sequence:CCGGCTATCAGAACTACCAGCGTATCTCGAGATACGCTGGTAGTTCTGATAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000019511    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_004526.2-2392s1c1
Sequence:CCGGCGCATCCATCTGCGGGACTATCTCGAGATAGTCCCGCAGATGGATGCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000019512    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_004526.2-1798s1c1
Sequence:CCGGCGAGGAGTGTGTCTCATTGATCTCGAGATCAATGAGACACACTCCTCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000019513    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_004526.2-2553s1c1
Sequence:CCGGGCTCTTCATACTGAAGCAGTTCTCGAGAACTGCTTCAGTATGAAGAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004526
VALIDATED
MCM2 MISSION shRNA Lentiviral Transduction Particles
minichromosome maintenance complex component 2
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000278372    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_004526.2-1164s21c1
Sequence:CCGGCTATCAGAACTACCAGCGTATCTCGAGATACGCTGGTAGTTCTGATAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278310    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_004526.2-2553s21c1
Sequence:CCGGGCTCTTCATACTGAAGCAGTTCTCGAGAACTGCTTCAGTATGAAGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278374    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 2 Clone ID:NM_004526.2-2392s21c1
Sequence:CCGGCGCATCCATCTGCGGGACTATCTCGAGATAGTCCCGCAGATGGATGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019509    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_004526.2-1587s1c1
Sequence:CCGGGCACAAGGTACGTGGTGATATCTCGAGATATCACCACGTACCTTGTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278309    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_004526.2-1587s21c1
Sequence:CCGGGCACAAGGTACGTGGTGATATCTCGAGATATCACCACGTACCTTGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278308    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004526.2-1798s21c1
Sequence:CCGGCGAGGAGTGTGTCTCATTGATCTCGAGATCAATGAGACACACTCCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019510    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_004526.2-1164s1c1
Sequence:CCGGCTATCAGAACTACCAGCGTATCTCGAGATACGCTGGTAGTTCTGATAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019511    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_004526.2-2392s1c1
Sequence:CCGGCGCATCCATCTGCGGGACTATCTCGAGATAGTCCCGCAGATGGATGCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019512    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_004526.2-1798s1c1
Sequence:CCGGCGAGGAGTGTGTCTCATTGATCTCGAGATCAATGAGACACACTCCTCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019513    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_004526.2-2553s1c1
Sequence:CCGGGCTCTTCATACTGAAGCAGTTCTCGAGAACTGCTTCAGTATGAAGAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)