EMAIL THIS PAGE TO A FRIEND

MCM3AP

minichromosome maintenance complex component 3 associated protein

52 Gene Product Result for
Synonyms: GANP MAP80 SAC3
UniProtKB ID: O60318, Q2M3C1, Q9UMT4
Gene ID:
Human(8888) Summary: The minichromosome maintenance protein 3 (MCM3) is one of the MCM proteins essential for the initiation of DNA replication. The protein encoded by this gene is a MCM3 binding protein. It was reported to have phosphorylation-dependent DNA-primase activity, which was up-regulated in antigen immunization induced germinal center. This protein was demonstrated to be an acetyltransferase that acetylates MCM3 and plays a role in DNA replication. The mutagenesis of a nuclear localization signal of MCM3 affects the binding of this protein with MCM3, suggesting that this protein may also facilitate MCM3 nuclear localization. [provided by RefSeq, Jul 2008]
Mouse(54387) minichromosome maintenance deficient 3 (S. cerevisiae) associated protein
Rat(294339) minichromosome maintenance complex component 3 associated protein
domestic guinea pig(100727739) minichromosome maintenance complex component 3 associated protein
Domestic Rabbit(100357248) minichromosome maintenance complex component 3 associated protein
naked mole-rat(101714594) minichromosome maintenance complex component 3 associated protein
sheep(101112441) minichromosome maintenance complex component 3 associated protein
Zebrafish(436589) MCM3 minichromosome maintenance deficient 3 (S. cerevisiae) associated protein
chicken(424036) minichromosome maintenance complex component 3 associated protein
dog(480810) minichromosome maintenance complex component 3 associated protein
cow(534293) minichromosome maintenance complex component 3 associated protein
Horse(100049836) minichromosome maintenance complex component 3 associated protein
domestic cat(101100147) minichromosome maintenance complex component 3 associated protein
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003906 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003906 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003906 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_019434 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_019434 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_019434 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003906 Rosetta Predictions human pricing
NM_001106382 Rosetta Predictions rat pricing
NM_019434 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003906 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00195876 predicted 2570
2 SASI_Hs01_00195877 predicted 3669
3 SASI_Hs01_00195878 predicted 1730
4 SASI_Hs01_00195880 predicted 5262
5 SASI_Hs01_00195881 predicted 1592
6 SASI_Hs01_00195883 predicted 4656
7 SASI_Hs01_00195884 predicted 1119
8 SASI_Hs01_00195885 predicted 784
9 SASI_Hs02_00336533 predicted 2612
10 SASI_Hs02_00336534 predicted 4740
11 SASI_Hs01_00195879 predicted 435
12 SASI_Hs01_00195882 predicted 4249
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106382 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00218418 predicted 4120
2 SASI_Rn02_00218419 predicted 5437
3 SASI_Rn02_00218420 predicted 868
4 SASI_Rn02_00218421 predicted 1385
5 SASI_Rn02_00218422 predicted 4775
6 SASI_Rn02_00218423 predicted 5071
7 SASI_Rn02_00218424 predicted 5179
8 SASI_Rn02_00218425 predicted 3372
9 SASI_Rn02_00218426 predicted 2906
10 SASI_Rn02_00218427 predicted 3928
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019434 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00324369 predicted 2860
2 SASI_Mm02_00324370 predicted 5143
3 SASI_Mm02_00324371 predicted 4910
4 SASI_Mm02_00324372 predicted 4870
5 SASI_Mm02_00324373 predicted 926
6 SASI_Mm02_00324374 predicted 3079
7 SASI_Mm02_00324375 predicted 1731
8 SASI_Mm02_00324376 predicted 1336
9 SASI_Mm02_00324377 predicted 5562
10 SASI_Mm02_00324378 predicted 2024
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003906
VALIDATED
MCM3AP MISSION shRNA Bacterial Glycerol Stock
minichromosome maintenance complex component 3 associated protein
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000353590    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 2 Clone ID:NM_003906.3-5868s21c1
Sequence:CCGGGTGTCTAGGCGAACGACTAAACTCGAGTTTAGTCGTTCGCCTAGACACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000330179    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_003906.3-116s21c1
Sequence:CCGGCTAAGCCGCCATTTCGATTTGCTCGAGCAAATCGAAATGGCGGCTTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000330104    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_003906.3-2531s21c1
Sequence:CCGGGAAACTCATCTGAGGTGAAATCTCGAGATTTCACCTCAGATGAGTTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000330101    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003906.3-86s21c1
Sequence:CCGGCGTCTTCTAGTAATGTAGGAACTCGAGTTCCTACATTACTAGAAGACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000330178    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_003906.3-4642s21c1
Sequence:CCGGGAGATCCCTGATACCATTAATCTCGAGATTAATGGTATCAGGGATCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183014    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_003906.3-86s1c1
Sequence:CCGGCGTCTTCTAGTAATGTAGGAACTCGAGTTCCTACATTACTAGAAGACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180875    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003906.3-3676s1c1
Sequence:CCGGGCCCACTTAGTGGACTTGTTTCTCGAGAAACAAGTCCACTAAGTGGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147895    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_003906.3-1518s1c1
Sequence:CCGGGCATAAAGACATGGCTATCTTCTCGAGAAGATAGCCATGTCTTTATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147338    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_003906.3-2531s1c1
Sequence:CCGGGAAACTCATCTGAGGTGAAATCTCGAGATTTCACCTCAGATGAGTTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146606    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_003906.3-5708s1c1
Sequence:CCGGCAGGAGCATTTACGGATTTAACTCGAGTTAAATCCGTAAATGCTCCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003906
VALIDATED
MCM3AP MISSION shRNA shRNA Plasmid DNA
minichromosome maintenance complex component 3 associated protein
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000353590    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 2 Clone ID:NM_003906.3-5868s21c1
Sequence:CCGGGTGTCTAGGCGAACGACTAAACTCGAGTTTAGTCGTTCGCCTAGACACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000330179    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_003906.3-116s21c1
Sequence:CCGGCTAAGCCGCCATTTCGATTTGCTCGAGCAAATCGAAATGGCGGCTTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000330104    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_003906.3-2531s21c1
Sequence:CCGGGAAACTCATCTGAGGTGAAATCTCGAGATTTCACCTCAGATGAGTTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000330101    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003906.3-86s21c1
Sequence:CCGGCGTCTTCTAGTAATGTAGGAACTCGAGTTCCTACATTACTAGAAGACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000330178    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_003906.3-4642s21c1
Sequence:CCGGGAGATCCCTGATACCATTAATCTCGAGATTAATGGTATCAGGGATCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000183014    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_003906.3-86s1c1
Sequence:CCGGCGTCTTCTAGTAATGTAGGAACTCGAGTTCCTACATTACTAGAAGACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000180875    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003906.3-3676s1c1
Sequence:CCGGGCCCACTTAGTGGACTTGTTTCTCGAGAAACAAGTCCACTAAGTGGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000147895    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_003906.3-1518s1c1
Sequence:CCGGGCATAAAGACATGGCTATCTTCTCGAGAAGATAGCCATGTCTTTATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000147338    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_003906.3-2531s1c1
Sequence:CCGGGAAACTCATCTGAGGTGAAATCTCGAGATTTCACCTCAGATGAGTTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000146606    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_003906.3-5708s1c1
Sequence:CCGGCAGGAGCATTTACGGATTTAACTCGAGTTAAATCCGTAAATGCTCCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003906
VALIDATED
MCM3AP MISSION shRNA Lentiviral Transduction Particles
minichromosome maintenance complex component 3 associated protein
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000353590    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 2 Clone ID:NM_003906.3-5868s21c1
Sequence:CCGGGTGTCTAGGCGAACGACTAAACTCGAGTTTAGTCGTTCGCCTAGACACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000330179    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_003906.3-116s21c1
Sequence:CCGGCTAAGCCGCCATTTCGATTTGCTCGAGCAAATCGAAATGGCGGCTTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000330104    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_003906.3-2531s21c1
Sequence:CCGGGAAACTCATCTGAGGTGAAATCTCGAGATTTCACCTCAGATGAGTTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000330101    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003906.3-86s21c1
Sequence:CCGGCGTCTTCTAGTAATGTAGGAACTCGAGTTCCTACATTACTAGAAGACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000330178    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_003906.3-4642s21c1
Sequence:CCGGGAGATCCCTGATACCATTAATCTCGAGATTAATGGTATCAGGGATCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183014    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_003906.3-86s1c1
Sequence:CCGGCGTCTTCTAGTAATGTAGGAACTCGAGTTCCTACATTACTAGAAGACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180875    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003906.3-3676s1c1
Sequence:CCGGGCCCACTTAGTGGACTTGTTTCTCGAGAAACAAGTCCACTAAGTGGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147895    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_003906.3-1518s1c1
Sequence:CCGGGCATAAAGACATGGCTATCTTCTCGAGAAGATAGCCATGTCTTTATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147338    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_003906.3-2531s1c1
Sequence:CCGGGAAACTCATCTGAGGTGAAATCTCGAGATTTCACCTCAGATGAGTTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146606    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_003906.3-5708s1c1
Sequence:CCGGCAGGAGCATTTACGGATTTAACTCGAGTTAAATCCGTAAATGCTCCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019434
VALIDATED
MCM3AP MISSION shRNA Bacterial Glycerol Stock
minichromosome maintenance complex component 3 associated protein
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000311938    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019434.2-5771s21c1
Sequence:CCGGCCATCCTCCTACAAGCACTTTCTCGAGAAAGTGCTTGTAGGAGGATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000311937    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019434.2-2862s21c1
Sequence:CCGGGCTGCATTGAACAGCAATAATCTCGAGATTATTGCTGTTCAATGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312966    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019434.2-2571s21c1
Sequence:CCGGATCGAGAAGTGTACCCGATTTCTCGAGAAATCGGGTACACTTCTCGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313009    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019434.2-5133s21c1
Sequence:CCGGCAGGAGCCTAGCACCATTATTCTCGAGAATAATGGTGCTAGGCTCCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000349409    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019434.2-4874s21c1
Sequence:CCGGCGGTCTGATGTTACAGGATTTCTCGAGAAATCCTGTAACATCAGACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119832    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_019434.1-2895s1c1
Sequence:CCGGGCTGCATTGAACAGCAATAATCTCGAGATTATTGCTGTTCAATGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119833    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_019434.1-4907s1c1
Sequence:CCGGCGGTCTGATGTTACAGGATTTCTCGAGAAATCCTGTAACATCAGACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119834    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_019434.1-3009s1c1
Sequence:CCGGCGGGCACTCAATGTTGCTTATCTCGAGATAAGCAACATTGAGTGCCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119836    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_019434.1-5804s1c1
Sequence:CCGGCCATCCTCCTACAAGCACTTTCTCGAGAAAGTGCTTGTAGGAGGATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119835    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_019434.1-445s1c1
Sequence:CCGGCCACGGGAACATATCAGACTACTCGAGTAGTCTGATATGTTCCCGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019434
VALIDATED
MCM3AP MISSION shRNA shRNA Plasmid DNA
minichromosome maintenance complex component 3 associated protein
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000311938    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019434.2-5771s21c1
Sequence:CCGGCCATCCTCCTACAAGCACTTTCTCGAGAAAGTGCTTGTAGGAGGATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000311937    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019434.2-2862s21c1
Sequence:CCGGGCTGCATTGAACAGCAATAATCTCGAGATTATTGCTGTTCAATGCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000312966    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019434.2-2571s21c1
Sequence:CCGGATCGAGAAGTGTACCCGATTTCTCGAGAAATCGGGTACACTTCTCGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000313009    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019434.2-5133s21c1
Sequence:CCGGCAGGAGCCTAGCACCATTATTCTCGAGAATAATGGTGCTAGGCTCCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000349409    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019434.2-4874s21c1
Sequence:CCGGCGGTCTGATGTTACAGGATTTCTCGAGAAATCCTGTAACATCAGACCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000119832    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_019434.1-2895s1c1
Sequence:CCGGGCTGCATTGAACAGCAATAATCTCGAGATTATTGCTGTTCAATGCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000119833    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_019434.1-4907s1c1
Sequence:CCGGCGGTCTGATGTTACAGGATTTCTCGAGAAATCCTGTAACATCAGACCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000119834    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_019434.1-3009s1c1
Sequence:CCGGCGGGCACTCAATGTTGCTTATCTCGAGATAAGCAACATTGAGTGCCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000119836    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_019434.1-5804s1c1
Sequence:CCGGCCATCCTCCTACAAGCACTTTCTCGAGAAAGTGCTTGTAGGAGGATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000119835    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_019434.1-445s1c1
Sequence:CCGGCCACGGGAACATATCAGACTACTCGAGTAGTCTGATATGTTCCCGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019434
VALIDATED
MCM3AP MISSION shRNA Lentiviral Transduction Particles
minichromosome maintenance complex component 3 associated protein
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000311938    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019434.2-5771s21c1
Sequence:CCGGCCATCCTCCTACAAGCACTTTCTCGAGAAAGTGCTTGTAGGAGGATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000311937    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019434.2-2862s21c1
Sequence:CCGGGCTGCATTGAACAGCAATAATCTCGAGATTATTGCTGTTCAATGCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312966    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019434.2-2571s21c1
Sequence:CCGGATCGAGAAGTGTACCCGATTTCTCGAGAAATCGGGTACACTTCTCGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313009    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019434.2-5133s21c1
Sequence:CCGGCAGGAGCCTAGCACCATTATTCTCGAGAATAATGGTGCTAGGCTCCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000349409    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019434.2-4874s21c1
Sequence:CCGGCGGTCTGATGTTACAGGATTTCTCGAGAAATCCTGTAACATCAGACCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119832    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_019434.1-2895s1c1
Sequence:CCGGGCTGCATTGAACAGCAATAATCTCGAGATTATTGCTGTTCAATGCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119833    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_019434.1-4907s1c1
Sequence:CCGGCGGTCTGATGTTACAGGATTTCTCGAGAAATCCTGTAACATCAGACCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119834    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_019434.1-3009s1c1
Sequence:CCGGCGGGCACTCAATGTTGCTTATCTCGAGATAAGCAACATTGAGTGCCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119836    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_019434.1-5804s1c1
Sequence:CCGGCCATCCTCCTACAAGCACTTTCTCGAGAAAGTGCTTGTAGGAGGATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119835    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_019434.1-445s1c1
Sequence:CCGGCCACGGGAACATATCAGACTACTCGAGTAGTCTGATATGTTCCCGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)