EMAIL THIS PAGE TO A FRIEND

MCM4

minichromosome maintenance complex component 4

89 Gene Product Result for
Synonyms: CDC21 CDC54 NKCD NKGCD P1-CDC21 hCdc21
UniProtKB ID: P33991, Q8NEH1, Q99658
Gene ID:
Human(4173) Summary: The protein encoded by this gene is one of the highly conserved mini-chromosome maintenance proteins (MCM) that are essential for the initiation of eukaryotic genome replication. The hexameric protein complex formed by MCM proteins is a key component of the pre-replication complex (pre_RC) and may be involved in the formation of replication forks and in the recruitment of other DNA replication related proteins. The MCM complex consisting of this protein and MCM2, 6 and 7 proteins possesses DNA helicase activity, and may act as a DNA unwinding enzyme. The phosphorylation of this protein by CDC2 kinase reduces the DNA helicase activity and chromatin binding of the MCM complex. This gene is mapped to a region on the chromosome 8 head-to-head next to the PRKDC/DNA-PK, a DNA-activated protein kinase involved in the repair of DNA double-strand breaks. Alternatively spliced transcript variants encoding the same protein have been reported. [provided by RefSeq, Jul 2008]
Mouse(17217) minichromosome maintenance deficient 4 homolog (S. cerevisiae)
Rat(29728) minichromosome maintenance complex component 4
Zebrafish(337598) MCM4 minichromosome maintenance deficient 4, mitotin (S. cerevisiae)
cow(504367) minichromosome maintenance complex component 4
Horse(100051303) minichromosome maintenance complex component 4
domestic cat(101089576) minichromosome maintenance complex component 4
dog(477871) minichromosome maintenance complex component 4
chicken(426764) minichromosome maintenance complex component 4
Thale Cress(816142) minichromosome maintenance protein 4
sheep(101105420) minichromosome maintenance complex component 4
naked mole-rat(101721409) minichromosome maintenance complex component 4
domestic guinea pig(100724549) minichromosome maintenance complex component 4
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
AV36649 Anti-MCM4 (AB1) antibody produced in rabbit IgG fraction of antiserum zebrafish, bovine, horse, mouse, guinea pig, rat, human, rabbit, canine
immunohistochemistry, western blot pricing
AV36662 Anti-MCM4 (AB2) antibody produced in rabbit IgG fraction of antiserum guinea pig, human, canine, mouse, rabbit, bovine, horse
western blot pricing
AV36663 Anti-MCM4 (AB3) antibody produced in rabbit IgG fraction of antiserum human, bovine, horse, rat, zebrafish, canine, rabbit, mouse, guinea pig
western blot pricing
SAB1406110 Anti-MCM4 antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
immunofluorescence, immunohistochemistry, western blot pricing
SAB2701721 Anti-mcm4 antibody produced in rabbit affinity isolated antibody, buffered aqueous solution zebrafish
immunohistochemistry, western blot pricing
HPA004873 Anti-MCM4 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry, western blot pricing
SAB4501846 Anti-MCM4 antibody produced in rabbit affinity isolated antibody human, mouse
ELISA, immunohistochemistry, western blot pricing
SAB2106394 Anti-MCM4 antibody produced in rabbit affinity isolated antibody horse, rat, human, guinea pig, rabbit
western blot pricing
HPA031052 Anti-MCM4 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody human
immunofluorescence, western blot pricing
SAB4504168 Anti-phospho-MCM4 (pSer54) antibody produced in rabbit affinity isolated antibody rat, mouse, human
ELISA, western blot pricing
PLA0039 Goat anti-MCM4 Antibody, Affinity Purified Powered by Bethyl Laboratories, Inc. rat, primate, gibbon, chimpanzee, rhesus monkey, human, guinea pig, rabbit, marmoset, gorilla
immunofluorescence, immunohistochemistry, proximity ligation assay, western blot pricing
SAB1402266 Monoclonal Anti-MCM4 antibody produced in mouse clone 1A6, purified immunoglobulin, buffered aqueous solution human
ELISA pricing
PLA0062 Rabbit anti-MCM4 Antibody, Affinity Purified Powered by Bethyl Laboratories, Inc. rhesus monkey, toad, mouse, human, gorilla, rabbit, primate, horse, guinea pig, marmoset, bovine, chimpanzee
immunofluorescence, immunohistochemistry, proximity ligation assay, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005914 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005914 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005914 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008565 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008565 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008565 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005914 Rosetta Predictions human pricing
NM_182746 Rosetta Predictions human pricing
XM_001068436 Rosetta Predictions rat pricing
XM_344048 Rosetta Predictions rat pricing
NM_008565 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005914 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00218872 predicted 2122
2 SASI_Hs01_00218873 predicted 1950
3 SASI_Hs01_00218874 predicted 1385
4 SASI_Hs01_00218877 predicted 1322
5 SASI_Hs01_00218878 predicted 1403
6 SASI_Hs02_00340536 predicted 2438
7 SASI_Hs01_00218879 predicted 1243
8 SASI_Hs02_00340537 predicted 2453
9 SASI_Hs01_00218880 predicted 434
10 SASI_Hs02_00340538 predicted 2693
11 SASI_Hs01_00218875 predicted 842
12 SASI_Hs01_00218876 predicted 2057
13 SASI_Hs01_00218881 predicted 426
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_182746 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00093809 predicted 2006
2 SASI_Hs01_00093810 predicted 1827
3 SASI_Hs01_00093811 predicted 1266
4 SASI_Hs01_00093814 predicted 1215
5 SASI_Hs01_00093815 predicted 1294
6 SASI_Hs02_00370897 predicted 2325
7 SASI_Hs01_00093816 predicted 1129
8 SASI_Hs02_00370898 predicted 2336
9 SASI_Hs01_00093817 predicted 319
10 SASI_Hs02_00370899 predicted 2582
11 SASI_Hs01_00093812 predicted 731
12 SASI_Hs01_00093813 predicted 1950
13 SASI_Hs01_00093818 predicted 311
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001068436 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00324517 predicted 900
2 SASI_Rn02_00324518 predicted 937
3 SASI_Rn02_00324519 predicted 655
4 SASI_Rn02_00324520 predicted 610
5 SASI_Rn02_00324521 predicted 305
6 SASI_Rn02_00324522 predicted 1619
7 SASI_Rn02_00324523 predicted 2388
8 SASI_Rn02_00324524 predicted 402
9 SASI_Rn02_00324525 predicted 2521
10 SASI_Rn02_00324526 predicted 2040
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_344048 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00396761 predicted 900
2 SASI_Rn02_00396762 predicted 942
3 SASI_Rn02_00396763 predicted 656
4 SASI_Rn02_00396764 predicted 607
5 SASI_Rn02_00396765 predicted 309
6 SASI_Rn02_00396766 predicted 1625
7 SASI_Rn02_00396767 predicted 2390
8 SASI_Rn02_00396768 predicted 409
9 SASI_Rn02_00396769 predicted 2518
10 SASI_Rn02_00396770 predicted 2042
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008565 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00314164 predicted 419
2 SASI_Mm02_00314165 predicted 923
3 SASI_Mm01_00184723 predicted 886
4 SASI_Mm01_00184724 predicted 1208
5 SASI_Mm01_00184725 predicted 2175
6 SASI_Mm01_00184726 predicted 386
7 SASI_Mm02_00314166 predicted 2019
8 SASI_Mm02_00314167 predicted 286
9 SASI_Mm02_00314168 predicted 1884
10 SASI_Mm02_00314169 predicted 939
11 SASI_Mm01_00184721 predicted 1118
12 SASI_Mm01_00184722 predicted 1981
13 SASI_Mm01_00184727 predicted 2793
14 SASI_Mm01_00184728 predicted 2175
15 SASI_Mm01_00184729 predicted 2144
16 SASI_Mm01_00184730 predicted 1526
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005914
VALIDATED
MCM4 MISSION shRNA Bacterial Glycerol Stock
minichromosome maintenance complex component 4
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000074243    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005914.2-3117s1c1
Sequence:CCGGCGTCTCTAGTAAAGATAACAACTCGAGTTGTTATCTTTACTAGAGACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074244    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005914.2-2264s1c1
Sequence:CCGGGCGGTGCTAAAGGACTACATTCTCGAGAATGTAGTCCTTTAGCACCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074245    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005914.2-959s1c1
Sequence:CCGGCCTGACTCAATCTTAGAACATCTCGAGATGTTCTAAGATTGAGTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074247    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005914.2-1577s1c1
Sequence:CCGGCCAGACATTTATGAGAGGCTTCTCGAGAAGCCTCTCATAAATGTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000344913    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005914.2-2887s21c1
Sequence:CCGGTCAGTGTAAATAGAGCTTAAACTCGAGTTTAAGCTCTATTTACACTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000344914    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_005914.2-769s21c1
Sequence:CCGGAGATATTACTGAACCTCTATACTCGAGTATAGAGGTTCAGTAATATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000293742    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_005914.2-2888s21c1
Sequence:CCGGCAGTGTAAATAGAGCTTAAAGCTCGAGCTTTAAGCTCTATTTACACTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286297    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005914.2-959s21c1
Sequence:CCGGCCTGACTCAATCTTAGAACATCTCGAGATGTTCTAAGATTGAGTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286231    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005914.2-1577s21c1
Sequence:CCGGCCAGACATTTATGAGAGGCTTCTCGAGAAGCCTCTCATAAATGTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286298    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_005914.2-2264s21c1
Sequence:CCGGGCGGTGCTAAAGGACTACATTCTCGAGAATGTAGTCCTTTAGCACCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000293683    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_005914.2-2111s21c1
Sequence:CCGGATCCAGCTGCCTCATACTTTACTCGAGTAAAGTATGAGGCAGCTGGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005914
VALIDATED
MCM4 MISSION shRNA shRNA Plasmid DNA
minichromosome maintenance complex component 4
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000074243    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005914.2-3117s1c1
Sequence:CCGGCGTCTCTAGTAAAGATAACAACTCGAGTTGTTATCTTTACTAGAGACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074244    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005914.2-2264s1c1
Sequence:CCGGGCGGTGCTAAAGGACTACATTCTCGAGAATGTAGTCCTTTAGCACCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074245    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005914.2-959s1c1
Sequence:CCGGCCTGACTCAATCTTAGAACATCTCGAGATGTTCTAAGATTGAGTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074247    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005914.2-1577s1c1
Sequence:CCGGCCAGACATTTATGAGAGGCTTCTCGAGAAGCCTCTCATAAATGTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000344913    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005914.2-2887s21c1
Sequence:CCGGTCAGTGTAAATAGAGCTTAAACTCGAGTTTAAGCTCTATTTACACTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000344914    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_005914.2-769s21c1
Sequence:CCGGAGATATTACTGAACCTCTATACTCGAGTATAGAGGTTCAGTAATATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000293742    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_005914.2-2888s21c1
Sequence:CCGGCAGTGTAAATAGAGCTTAAAGCTCGAGCTTTAAGCTCTATTTACACTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000286297    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005914.2-959s21c1
Sequence:CCGGCCTGACTCAATCTTAGAACATCTCGAGATGTTCTAAGATTGAGTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000286231    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005914.2-1577s21c1
Sequence:CCGGCCAGACATTTATGAGAGGCTTCTCGAGAAGCCTCTCATAAATGTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000286298    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_005914.2-2264s21c1
Sequence:CCGGGCGGTGCTAAAGGACTACATTCTCGAGAATGTAGTCCTTTAGCACCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000293683    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_005914.2-2111s21c1
Sequence:CCGGATCCAGCTGCCTCATACTTTACTCGAGTAAAGTATGAGGCAGCTGGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005914
VALIDATED
MCM4 MISSION shRNA Lentiviral Transduction Particles
minichromosome maintenance complex component 4
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000074243    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005914.2-3117s1c1
Sequence:CCGGCGTCTCTAGTAAAGATAACAACTCGAGTTGTTATCTTTACTAGAGACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074244    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005914.2-2264s1c1
Sequence:CCGGGCGGTGCTAAAGGACTACATTCTCGAGAATGTAGTCCTTTAGCACCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074245    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005914.2-959s1c1
Sequence:CCGGCCTGACTCAATCTTAGAACATCTCGAGATGTTCTAAGATTGAGTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074247    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005914.2-1577s1c1
Sequence:CCGGCCAGACATTTATGAGAGGCTTCTCGAGAAGCCTCTCATAAATGTCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000344913    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005914.2-2887s21c1
Sequence:CCGGTCAGTGTAAATAGAGCTTAAACTCGAGTTTAAGCTCTATTTACACTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000344914    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_005914.2-769s21c1
Sequence:CCGGAGATATTACTGAACCTCTATACTCGAGTATAGAGGTTCAGTAATATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000293742    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_005914.2-2888s21c1
Sequence:CCGGCAGTGTAAATAGAGCTTAAAGCTCGAGCTTTAAGCTCTATTTACACTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286297    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005914.2-959s21c1
Sequence:CCGGCCTGACTCAATCTTAGAACATCTCGAGATGTTCTAAGATTGAGTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286231    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005914.2-1577s21c1
Sequence:CCGGCCAGACATTTATGAGAGGCTTCTCGAGAAGCCTCTCATAAATGTCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286298    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_005914.2-2264s21c1
Sequence:CCGGGCGGTGCTAAAGGACTACATTCTCGAGAATGTAGTCCTTTAGCACCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000293683    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_005914.2-2111s21c1
Sequence:CCGGATCCAGCTGCCTCATACTTTACTCGAGTAAAGTATGAGGCAGCTGGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008565
VALIDATED
MCM4 MISSION shRNA Bacterial Glycerol Stock
minichromosome maintenance complex component 4
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000124279    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008565.2-3150s1c1
Sequence:CCGGCCGTACATCCTTTACTGTGATCTCGAGATCACAGTAAAGGATGTACGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124280    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008565.2-1199s1c1
Sequence:CCGGCCGATCATTCTTCTCTGACAACTCGAGTTGTCAGAGAAGAATGATCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124281    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008565.2-2226s1c1
Sequence:CCGGGCCGTGCTGAAAGACTACATTCTCGAGAATGTAGTCTTTCAGCACGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124282    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008565.2-360s1c1
Sequence:CCGGCCTGCACAGAATGCCTTGTTTCTCGAGAAACAAGGCATTCTGTGCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124283    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_008565.2-921s1c1
Sequence:CCGGCCTGACTCCATCTTAGAACATCTCGAGATGTTCTAAGATGGAGTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000315492    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008565.2-2226s21c1
Sequence:CCGGGCCGTGCTGAAAGACTACATTCTCGAGAATGTAGTCTTTCAGCACGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000311211    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008565.2-855s21c1
Sequence:CCGGTCCTACCCACAGGAGGTTATACTCGAGTATAACCTCCTGTGGGTAGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305014    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008565.2-2827s21c1
Sequence:CCGGGGCAGTATTCCACTATATAAACTCGAGTTTATATAGTGGAATACTGCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305015    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008565.2-2504s21c1
Sequence:CCGGTACTGGCATTGTGGATATTTCCTCGAGGAAATATCCACAATGCCAGTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000311212    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008565.2-1335s21c1
Sequence:CCGGGTGAACGTCACAGGCATATATCTCGAGATATATGCCTGTGACGTTCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008565
VALIDATED
MCM4 MISSION shRNA shRNA Plasmid DNA
minichromosome maintenance complex component 4
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000124279    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008565.2-3150s1c1
Sequence:CCGGCCGTACATCCTTTACTGTGATCTCGAGATCACAGTAAAGGATGTACGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000124280    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008565.2-1199s1c1
Sequence:CCGGCCGATCATTCTTCTCTGACAACTCGAGTTGTCAGAGAAGAATGATCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000124281    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008565.2-2226s1c1
Sequence:CCGGGCCGTGCTGAAAGACTACATTCTCGAGAATGTAGTCTTTCAGCACGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000124282    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008565.2-360s1c1
Sequence:CCGGCCTGCACAGAATGCCTTGTTTCTCGAGAAACAAGGCATTCTGTGCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000124283    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_008565.2-921s1c1
Sequence:CCGGCCTGACTCCATCTTAGAACATCTCGAGATGTTCTAAGATGGAGTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000315492    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008565.2-2226s21c1
Sequence:CCGGGCCGTGCTGAAAGACTACATTCTCGAGAATGTAGTCTTTCAGCACGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000311211    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008565.2-855s21c1
Sequence:CCGGTCCTACCCACAGGAGGTTATACTCGAGTATAACCTCCTGTGGGTAGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000305014    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008565.2-2827s21c1
Sequence:CCGGGGCAGTATTCCACTATATAAACTCGAGTTTATATAGTGGAATACTGCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000305015    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008565.2-2504s21c1
Sequence:CCGGTACTGGCATTGTGGATATTTCCTCGAGGAAATATCCACAATGCCAGTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000311212    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008565.2-1335s21c1
Sequence:CCGGGTGAACGTCACAGGCATATATCTCGAGATATATGCCTGTGACGTTCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008565
VALIDATED
MCM4 MISSION shRNA Lentiviral Transduction Particles
minichromosome maintenance complex component 4
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000124279    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008565.2-3150s1c1
Sequence:CCGGCCGTACATCCTTTACTGTGATCTCGAGATCACAGTAAAGGATGTACGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124280    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008565.2-1199s1c1
Sequence:CCGGCCGATCATTCTTCTCTGACAACTCGAGTTGTCAGAGAAGAATGATCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124281    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008565.2-2226s1c1
Sequence:CCGGGCCGTGCTGAAAGACTACATTCTCGAGAATGTAGTCTTTCAGCACGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124282    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008565.2-360s1c1
Sequence:CCGGCCTGCACAGAATGCCTTGTTTCTCGAGAAACAAGGCATTCTGTGCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124283    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_008565.2-921s1c1
Sequence:CCGGCCTGACTCCATCTTAGAACATCTCGAGATGTTCTAAGATGGAGTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000315492    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008565.2-2226s21c1
Sequence:CCGGGCCGTGCTGAAAGACTACATTCTCGAGAATGTAGTCTTTCAGCACGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000311211    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008565.2-855s21c1
Sequence:CCGGTCCTACCCACAGGAGGTTATACTCGAGTATAACCTCCTGTGGGTAGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305014    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008565.2-2827s21c1
Sequence:CCGGGGCAGTATTCCACTATATAAACTCGAGTTTATATAGTGGAATACTGCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305015    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008565.2-2504s21c1
Sequence:CCGGTACTGGCATTGTGGATATTTCCTCGAGGAAATATCCACAATGCCAGTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000311212    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008565.2-1335s21c1
Sequence:CCGGGTGAACGTCACAGGCATATATCTCGAGATATATGCCTGTGACGTTCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)