EMAIL THIS PAGE TO A FRIEND

MCM5

minichromosome maintenance complex component 5

78 Gene Product Result for
Synonyms: CDC46 P1-CDC46
UniProtKB ID: P33992, O60785, Q14578, Q9BTJ4, Q9BWL8
Gene ID:
Human(4174) Summary: The protein encoded by this gene is structurally very similar to the CDC46 protein from S. cerevisiae, a protein involved in the initiation of DNA replication. The encoded protein is a member of the MCM family of chromatin-binding proteins and can interact with at least two other members of this family. The encoded protein is upregulated in the transition from the G0 to G1/S phase of the cell cycle and may actively participate in cell cycle regulation. [provided by RefSeq, Jul 2008]
Mouse(17218) minichromosome maintenance deficient 5, cell division cycle 46 (S. cerevisiae)
Rat(291885) minichromosome maintenance complex component 5
domestic guinea pig(100712965) minichromosome maintenance complex component 5
naked mole-rat(101708511) minichromosome maintenance complex component 5
Domestic Rabbit(100345230) minichromosome maintenance complex component 5
sheep(101104055) minichromosome maintenance complex component 5
Zebrafish(286747) MCM5 minichromosome maintenance deficient 5 (S. cerevisiae)
fruit fly(41296) Minichromosome maintenance 5
chicken(418058) minichromosome maintenance complex component 5
dog(610519) minichromosome maintenance complex component 5
cow(506970) minichromosome maintenance complex component 5
Horse(100054340) minichromosome maintenance complex component 5
domestic cat(101092865) minichromosome maintenance complex component 5
Thale Cress(815415) minichromosome maintenance protein 5
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006739 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006739 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006739 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008566 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008566 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008566 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006739 Rosetta Predictions human pricing
NM_001106170 Rosetta Predictions rat pricing
NM_008566 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006739 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00075532 predicted 885
2 SASI_Hs01_00075533 predicted 716
3 SASI_Hs02_00342188 predicted 1196
4 SASI_Hs01_00075534 predicted 1636
5 SASI_Hs01_00075535 predicted 294
6 SASI_Hs01_00075536 predicted 1835
7 SASI_Hs01_00075537 predicted 715
8 SASI_Hs01_00075538 predicted 1598
9 SASI_Hs01_00075539 predicted 246
10 SASI_Hs01_00075540 predicted 1444
11 SASI_Hs01_00075541 predicted 526
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106170 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00216318 predicted 1500
2 SASI_Rn02_00216319 predicted 1541
3 SASI_Rn02_00216320 predicted 1480
4 SASI_Rn02_00216321 predicted 1596
5 SASI_Rn02_00216322 predicted 1478
6 SASI_Rn02_00216323 predicted 1298
7 SASI_Rn02_00216324 predicted 1739
8 SASI_Rn02_00216325 predicted 1274
9 SASI_Rn02_00216326 predicted 2208
10 SASI_Rn02_00216327 predicted 1545
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008566 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00157007 predicted 1696
2 SASI_Mm01_00157008 predicted 1371
3 SASI_Mm01_00157009 predicted 2200
4 SASI_Mm02_00314170 predicted 201
5 SASI_Mm01_00157010 predicted 1606
6 SASI_Mm01_00157011 predicted 2309
7 SASI_Mm01_00157012 predicted 1219
8 SASI_Mm02_00314171 predicted 624
9 SASI_Mm01_00157015 predicted 254
10 SASI_Mm02_00314172 predicted 1939
11 SASI_Mm01_00157013 predicted 1828
12 SASI_Mm01_00157014 predicted 1629
13 SASI_Mm01_00157016 predicted 888
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006739
VALIDATED
MCM5 MISSION shRNA Bacterial Glycerol Stock
minichromosome maintenance complex component 5
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000433317    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006739.3-729s21c1
Sequence:CCGGACTTCATCATGCCCGACAAATCTCGAGATTTGTCGGGCATGATGAAGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425814    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006739.3-897s21c1
Sequence:CCGGTCTACTCCATCAAGAAGTTTGCTCGAGCAAACTTCTTGATGGAGTAGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420069    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006739.3-263s21c1
Sequence:CCGGGATGAACTCAAGCGGCATTACCTCGAGGTAATGCCGCTTGAGTTCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417228    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006739.3-463s21c1
Sequence:CCGGCATCCAGGTCATGCTCAAGTCCTCGAGGACTTGAGCATGACCTGGATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412286    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006739.3-1628s21c1
Sequence:CCGGTCGCGCTTCGACATGATCTTCCTCGAGGAAGATCATGTCGAAGCGCGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413912    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006739.3-1201s21c1
Sequence:CCGGTACTCGCCGAGGAGACATCAACTCGAGTTGATGTCTCCTCGGCGAGTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414809    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006739.3-1763s21c1
Sequence:CCGGGCCAAGCTGAAGAAGTTTATTCTCGAGAATAAACTTCTTCAGCTTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421396    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006739.3-1355s21c1
Sequence:CCGGGACCCTTCGTCCCGGAATTTCCTCGAGGAAATTCCGGGACGAAGGGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010517    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A3
TRC Version: 1 Clone ID:NM_006739.x-226s1c1
Sequence:CCGGCACGGGCTTCACCTTCAAATACTCGAGTATTTGAAGGTGAAGCCCGTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000270    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A3
TRC Version: 1 Clone ID:NM_006739.x-1819s1c1
Sequence:CCGGAGAGAAACTGAAGAACCGCTACTCGAGTAGCGGTTCTTCAGTTTCTCTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000269    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A3
TRC Version: 1 Clone ID:NM_006739.x-283s1c1
Sequence:CCGGGTACTGGATTGAGGTGGAGATCTCGAGATCTCCACCTCAATCCAGTACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000268    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_006739.x-1822s1c1
Sequence:CCGGGAAACTGAAGAACCGCTACATCTCGAGATGTAGCGGTTCTTCAGTTTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000267    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A3
TRC Version: 1 Clone ID:NM_006739.x-2155s1c1
Sequence:CCGGGCACAGCATCATCAAGGACTTCTCGAGAAGTCCTTGATGATGCTGTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006739
VALIDATED
MCM5 MISSION shRNA shRNA Plasmid DNA
minichromosome maintenance complex component 5
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000433317    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006739.3-729s21c1
Sequence:CCGGACTTCATCATGCCCGACAAATCTCGAGATTTGTCGGGCATGATGAAGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000425814    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006739.3-897s21c1
Sequence:CCGGTCTACTCCATCAAGAAGTTTGCTCGAGCAAACTTCTTGATGGAGTAGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000420069    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006739.3-263s21c1
Sequence:CCGGGATGAACTCAAGCGGCATTACCTCGAGGTAATGCCGCTTGAGTTCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000417228    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006739.3-463s21c1
Sequence:CCGGCATCCAGGTCATGCTCAAGTCCTCGAGGACTTGAGCATGACCTGGATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000412286    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006739.3-1628s21c1
Sequence:CCGGTCGCGCTTCGACATGATCTTCCTCGAGGAAGATCATGTCGAAGCGCGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000413912    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006739.3-1201s21c1
Sequence:CCGGTACTCGCCGAGGAGACATCAACTCGAGTTGATGTCTCCTCGGCGAGTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000414809    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006739.3-1763s21c1
Sequence:CCGGGCCAAGCTGAAGAAGTTTATTCTCGAGAATAAACTTCTTCAGCTTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000421396    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006739.3-1355s21c1
Sequence:CCGGGACCCTTCGTCCCGGAATTTCCTCGAGGAAATTCCGGGACGAAGGGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000010517    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A3
TRC Version: 1 Clone ID:NM_006739.x-226s1c1
Sequence:CCGGCACGGGCTTCACCTTCAAATACTCGAGTATTTGAAGGTGAAGCCCGTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000000270    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A3
TRC Version: 1 Clone ID:NM_006739.x-1819s1c1
Sequence:CCGGAGAGAAACTGAAGAACCGCTACTCGAGTAGCGGTTCTTCAGTTTCTCTTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000000269    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A3
TRC Version: 1 Clone ID:NM_006739.x-283s1c1
Sequence:CCGGGTACTGGATTGAGGTGGAGATCTCGAGATCTCCACCTCAATCCAGTACTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000000268    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_006739.x-1822s1c1
Sequence:CCGGGAAACTGAAGAACCGCTACATCTCGAGATGTAGCGGTTCTTCAGTTTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000000267    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A3
TRC Version: 1 Clone ID:NM_006739.x-2155s1c1
Sequence:CCGGGCACAGCATCATCAAGGACTTCTCGAGAAGTCCTTGATGATGCTGTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006739
VALIDATED
MCM5 MISSION shRNA Lentiviral Transduction Particles
minichromosome maintenance complex component 5
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000433317    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006739.3-729s21c1
Sequence:CCGGACTTCATCATGCCCGACAAATCTCGAGATTTGTCGGGCATGATGAAGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425814    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006739.3-897s21c1
Sequence:CCGGTCTACTCCATCAAGAAGTTTGCTCGAGCAAACTTCTTGATGGAGTAGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420069    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006739.3-263s21c1
Sequence:CCGGGATGAACTCAAGCGGCATTACCTCGAGGTAATGCCGCTTGAGTTCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417228    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006739.3-463s21c1
Sequence:CCGGCATCCAGGTCATGCTCAAGTCCTCGAGGACTTGAGCATGACCTGGATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412286    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006739.3-1628s21c1
Sequence:CCGGTCGCGCTTCGACATGATCTTCCTCGAGGAAGATCATGTCGAAGCGCGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413912    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006739.3-1201s21c1
Sequence:CCGGTACTCGCCGAGGAGACATCAACTCGAGTTGATGTCTCCTCGGCGAGTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414809    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006739.3-1763s21c1
Sequence:CCGGGCCAAGCTGAAGAAGTTTATTCTCGAGAATAAACTTCTTCAGCTTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421396    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006739.3-1355s21c1
Sequence:CCGGGACCCTTCGTCCCGGAATTTCCTCGAGGAAATTCCGGGACGAAGGGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010517    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A3
TRC Version: 1 Clone ID:NM_006739.x-226s1c1
Sequence:CCGGCACGGGCTTCACCTTCAAATACTCGAGTATTTGAAGGTGAAGCCCGTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000270    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A3
TRC Version: 1 Clone ID:NM_006739.x-1819s1c1
Sequence:CCGGAGAGAAACTGAAGAACCGCTACTCGAGTAGCGGTTCTTCAGTTTCTCTTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000269    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A3
TRC Version: 1 Clone ID:NM_006739.x-283s1c1
Sequence:CCGGGTACTGGATTGAGGTGGAGATCTCGAGATCTCCACCTCAATCCAGTACTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000268    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_006739.x-1822s1c1
Sequence:CCGGGAAACTGAAGAACCGCTACATCTCGAGATGTAGCGGTTCTTCAGTTTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000267    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A3
TRC Version: 1 Clone ID:NM_006739.x-2155s1c1
Sequence:CCGGGCACAGCATCATCAAGGACTTCTCGAGAAGTCCTTGATGATGCTGTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008566
VALIDATED
MCM5 MISSION shRNA Bacterial Glycerol Stock
minichromosome maintenance complex component 5
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000312209    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008566.2-1644s21c1
Sequence:CCGGTGATATGATCTTCATCGTCAACTCGAGTTGACGATGAAGATCATATCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312259    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008566.2-2121s21c1
Sequence:CCGGCCGCATTGAGAAGCAACTCAACTCGAGTTGAGTTGCTTCTCAATGCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312257    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008566.2-1624s21c1
Sequence:CCGGCCTACCATCTTGTCCCGATTTCTCGAGAAATCGGGACAAGATGGTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313276    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008566.2-1206s21c1
Sequence:CCGGACTCACTCGCCGAGGTGATATCTCGAGATATCACCTCGGCGAGTGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000349880    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008566.2-2611s21c1
Sequence:CCGGTTGTATGTACAGAGGTAATAACTCGAGTTATTACCTCTGTACATACAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127209    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008566.1-2411s1c1
Sequence:CCGGCCTGGAAATGTACTTTGGTCTCTCGAGAGACCAAAGTACATTTCCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127213    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008566.1-1623s1c1
Sequence:CCGGTGATATGATCTTCATCGTCAACTCGAGTTGACGATGAAGATCATATCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127212    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008566.1-2100s1c1
Sequence:CCGGCCGCATTGAGAAGCAACTCAACTCGAGTTGAGTTGCTTCTCAATGCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127210    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008566.1-1603s1c1
Sequence:CCGGCCTACCATCTTGTCCCGATTTCTCGAGAAATCGGGACAAGATGGTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127211    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008566.1-657s1c1
Sequence:CCGGCCTTCCCAGGAAGTGCAATATCTCGAGATATTGCACTTCCTGGGAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008566
VALIDATED
MCM5 MISSION shRNA shRNA Plasmid DNA
minichromosome maintenance complex component 5
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000312209    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008566.2-1644s21c1
Sequence:CCGGTGATATGATCTTCATCGTCAACTCGAGTTGACGATGAAGATCATATCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000312259    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008566.2-2121s21c1
Sequence:CCGGCCGCATTGAGAAGCAACTCAACTCGAGTTGAGTTGCTTCTCAATGCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000312257    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008566.2-1624s21c1
Sequence:CCGGCCTACCATCTTGTCCCGATTTCTCGAGAAATCGGGACAAGATGGTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000313276    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008566.2-1206s21c1
Sequence:CCGGACTCACTCGCCGAGGTGATATCTCGAGATATCACCTCGGCGAGTGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000349880    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008566.2-2611s21c1
Sequence:CCGGTTGTATGTACAGAGGTAATAACTCGAGTTATTACCTCTGTACATACAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000127209    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008566.1-2411s1c1
Sequence:CCGGCCTGGAAATGTACTTTGGTCTCTCGAGAGACCAAAGTACATTTCCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000127213    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008566.1-1623s1c1
Sequence:CCGGTGATATGATCTTCATCGTCAACTCGAGTTGACGATGAAGATCATATCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000127212    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008566.1-2100s1c1
Sequence:CCGGCCGCATTGAGAAGCAACTCAACTCGAGTTGAGTTGCTTCTCAATGCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000127210    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008566.1-1603s1c1
Sequence:CCGGCCTACCATCTTGTCCCGATTTCTCGAGAAATCGGGACAAGATGGTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000127211    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008566.1-657s1c1
Sequence:CCGGCCTTCCCAGGAAGTGCAATATCTCGAGATATTGCACTTCCTGGGAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008566
VALIDATED
MCM5 MISSION shRNA Lentiviral Transduction Particles
minichromosome maintenance complex component 5
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000312209    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008566.2-1644s21c1
Sequence:CCGGTGATATGATCTTCATCGTCAACTCGAGTTGACGATGAAGATCATATCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312259    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008566.2-2121s21c1
Sequence:CCGGCCGCATTGAGAAGCAACTCAACTCGAGTTGAGTTGCTTCTCAATGCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312257    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008566.2-1624s21c1
Sequence:CCGGCCTACCATCTTGTCCCGATTTCTCGAGAAATCGGGACAAGATGGTAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313276    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008566.2-1206s21c1
Sequence:CCGGACTCACTCGCCGAGGTGATATCTCGAGATATCACCTCGGCGAGTGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000349880    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008566.2-2611s21c1
Sequence:CCGGTTGTATGTACAGAGGTAATAACTCGAGTTATTACCTCTGTACATACAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127209    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008566.1-2411s1c1
Sequence:CCGGCCTGGAAATGTACTTTGGTCTCTCGAGAGACCAAAGTACATTTCCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127213    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008566.1-1623s1c1
Sequence:CCGGTGATATGATCTTCATCGTCAACTCGAGTTGACGATGAAGATCATATCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127212    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008566.1-2100s1c1
Sequence:CCGGCCGCATTGAGAAGCAACTCAACTCGAGTTGAGTTGCTTCTCAATGCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127210    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008566.1-1603s1c1
Sequence:CCGGCCTACCATCTTGTCCCGATTTCTCGAGAAATCGGGACAAGATGGTAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127211    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008566.1-657s1c1
Sequence:CCGGCCTTCCCAGGAAGTGCAATATCTCGAGATATTGCACTTCCTGGGAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)