EMAIL THIS PAGE TO A FRIEND

MCM6

minichromosome maintenance complex component 6

60 Gene Product Result for
Synonyms: MCG40308 Mis5 P105MCM
UniProtKB ID: Q14566, B2R6H2, Q13504, Q99859
Gene ID:
Human(4175) Summary: The protein encoded by this gene is one of the highly conserved mini-chromosome maintenance proteins (MCM) that are essential for the initiation of eukaryotic genome replication. The hexameric protein complex formed by the MCM proteins is a key component of the pre-replication complex (pre_RC) and may be involved in the formation of replication forks and in the recruitment of other DNA replication related proteins. The MCM complex consisting of this protein and MCM2, 4 and 7 proteins possesses DNA helicase activity, and may act as a DNA unwinding enzyme. The phosphorylation of the complex by CDC2 kinase reduces the helicase activity, suggesting a role in the regulation of DNA replication. Single nucleotide polymorphisms in the intron regions of this gene are associated with differential transcriptional activation of the promoter of the neighboring lactase gene and, thereby, influence lactose intolerance in early adulthood. [provided by RefSeq, May 2012]
Mouse(17219) minichromosome maintenance deficient 6 (MIS5 homolog, S. pombe) (S. cerevisiae)
Rat(29685) minichromosome maintenance complex component 6
Zebrafish(566409) MCM6 minichromosome maintenance deficient 6, mitotin (S. cerevisiae)
cow(517812) minichromosome maintenance complex component 6
Thale Cress(834492) minichromosome maintenance protein 6
domestic cat(101092703) minichromosome maintenance complex component 6
dog(476131) minichromosome maintenance complex component 6
chicken(424295) minichromosome maintenance complex component 6
fruit fly(31603) Minichromosome maintenance 6
sheep(101103786) minichromosome maintenance complex component 6
Domestic Rabbit(100343390) minichromosome maintenance complex component 6
naked mole-rat(101698140) minichromosome maintenance complex component 6
domestic guinea pig(100731891) minichromosome maintenance complex component 6
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1406112 Anti-MCM6 antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
immunofluorescence, immunohistochemistry, proximity ligation assay, western blot pricing
HPA004818 Anti-MCM6 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution Antibody Enhanced Validation human, mouse, rat
immunofluorescence, immunohistochemistry, western blot pricing
AV36650 Anti-MCM6 antibody produced in rabbit affinity isolated antibody human, rabbit, canine, guinea pig, horse
immunohistochemistry, western blot pricing
SAB2106395 Anti-MCM6 antibody produced in rabbit affinity isolated antibody canine, rat, human, guinea pig, mouse, horse, rabbit, bovine
immunohistochemistry, western blot pricing
SAB1410777 Anti-MCM6 antibody produced in rabbit purified immunoglobulin, buffered aqueous solution human
western blot pricing
PLA0041 Goat anti-MCM6 Antibody, Affinity Purified Powered by Bethyl Laboratories, Inc. chimpanzee, rhesus monkey, dog, gibbon, primate, human, bovine, gorilla, horse
immunofluorescence, immunohistochemistry, proximity ligation assay, western blot pricing
PLA0063 Rabbit anti-MCM6 Antibody, Affinity Purified Powered by Bethyl Laboratories, Inc. gibbon, rhesus monkey, primate, horse, human, chimpanzee, gorilla, dog, bovine, mouse
immunofluorescence, immunohistochemistry, proximity ligation assay, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005915 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005915 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005915 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008567 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008567 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008567 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005915 Rosetta Predictions human pricing
NM_017287 Rosetta Predictions rat pricing
NM_008567 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005915 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00215127 predicted 309
2 SASI_Hs01_00215129 predicted 1412
3 SASI_Hs01_00215131 predicted 2531
4 SASI_Hs02_00340539 predicted 1807
5 SASI_Hs01_00215132 predicted 1785
6 SASI_Hs01_00215133 predicted 1502
7 SASI_Hs01_00215134 predicted 1846
8 SASI_Hs02_00340540 predicted 2116
9 SASI_Hs02_00340541 predicted 1184
10 SASI_Hs01_00215135 predicted 1260
11 SASI_Hs01_00215128 predicted 1394
12 SASI_Hs01_00215130 predicted 1702
13 SASI_Hs01_00215136 predicted 2254
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017287 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00261716 predicted 1446
2 SASI_Rn02_00261717 predicted 2451
3 SASI_Rn02_00261718 predicted 1506
4 SASI_Rn02_00261719 predicted 1304
5 SASI_Rn02_00261720 predicted 1622
6 SASI_Rn02_00261721 predicted 2517
7 SASI_Rn02_00261722 predicted 377
8 SASI_Rn02_00261723 predicted 321
9 SASI_Rn02_00261724 predicted 1766
10 SASI_Rn02_00261725 predicted 467
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008567 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00036105 predicted 2435
2 SASI_Mm01_00036106 predicted 1491
3 SASI_Mm01_00036107 predicted 522
4 SASI_Mm01_00036108 predicted 2549
5 SASI_Mm01_00036109 predicted 432
6 SASI_Mm01_00036110 predicted 883
7 SASI_Mm02_00314173 predicted 1197
8 SASI_Mm01_00036112 predicted 2404
9 SASI_Mm01_00036113 predicted 1737
10 SASI_Mm01_00036114 predicted 1767
11 SASI_Mm01_00036111 predicted 2034
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005915
VALIDATED
MCM6 MISSION shRNA Bacterial Glycerol Stock
minichromosome maintenance complex component 6
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000019674    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_005915.4-738s1c1
Sequence:CCGGCCCGCAGTTTAGAAGTAATTTCTCGAGAAATTACTTCTAAACTGCGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019675    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_005915.4-2519s1c1
Sequence:CCGGCCTAACTACTTGCTCGAAGATCTCGAGATCTTCGAGCAAGTAGTTAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019677    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_005915.4-1659s1c1
Sequence:CCGGCCCGATTCGATCTCTTCTTTACTCGAGTAAAGAAGAGATCGAATCGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019678    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005915.4-1142s1c1
Sequence:CCGGCCTACTATACATGGCAATGATCTCGAGATCATTGCCATGTATAGTAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019676    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005915.4-949s1c1
Sequence:CCGGCCTTTCTTATAGGCTGGTCTTCTCGAGAAGACCAGCCTATAAGAAAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275721    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 2 Clone ID:NM_005915.4-1142s21c1
Sequence:CCGGCCTACTATACATGGCAATGATCTCGAGATCATTGCCATGTATAGTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275722    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_005915.4-738s21c1
Sequence:CCGGCCCGCAGTTTAGAAGTAATTTCTCGAGAAATTACTTCTAAACTGCGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275649    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_005915.4-2237s21c1
Sequence:CCGGTGCCGAATCTCTAACCTTATTCTCGAGAATAAGGTTAGAGATTCGGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275651    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005915.4-2954s21c1
Sequence:CCGGTCTACTGTACCCTGATTATTACTCGAGTAATAATCAGGGTACAGTAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275723    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_005915.4-1659s21c1
Sequence:CCGGCCCGATTCGATCTCTTCTTTACTCGAGTAAAGAAGAGATCGAATCGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005915
VALIDATED
MCM6 MISSION shRNA shRNA Plasmid DNA
minichromosome maintenance complex component 6
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000019674    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_005915.4-738s1c1
Sequence:CCGGCCCGCAGTTTAGAAGTAATTTCTCGAGAAATTACTTCTAAACTGCGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000019675    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_005915.4-2519s1c1
Sequence:CCGGCCTAACTACTTGCTCGAAGATCTCGAGATCTTCGAGCAAGTAGTTAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000019677    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_005915.4-1659s1c1
Sequence:CCGGCCCGATTCGATCTCTTCTTTACTCGAGTAAAGAAGAGATCGAATCGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000019678    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005915.4-1142s1c1
Sequence:CCGGCCTACTATACATGGCAATGATCTCGAGATCATTGCCATGTATAGTAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000019676    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005915.4-949s1c1
Sequence:CCGGCCTTTCTTATAGGCTGGTCTTCTCGAGAAGACCAGCCTATAAGAAAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000275721    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 2 Clone ID:NM_005915.4-1142s21c1
Sequence:CCGGCCTACTATACATGGCAATGATCTCGAGATCATTGCCATGTATAGTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000275722    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_005915.4-738s21c1
Sequence:CCGGCCCGCAGTTTAGAAGTAATTTCTCGAGAAATTACTTCTAAACTGCGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000275649    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_005915.4-2237s21c1
Sequence:CCGGTGCCGAATCTCTAACCTTATTCTCGAGAATAAGGTTAGAGATTCGGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000275651    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005915.4-2954s21c1
Sequence:CCGGTCTACTGTACCCTGATTATTACTCGAGTAATAATCAGGGTACAGTAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000275723    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_005915.4-1659s21c1
Sequence:CCGGCCCGATTCGATCTCTTCTTTACTCGAGTAAAGAAGAGATCGAATCGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005915
VALIDATED
MCM6 MISSION shRNA Lentiviral Transduction Particles
minichromosome maintenance complex component 6
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000019674    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_005915.4-738s1c1
Sequence:CCGGCCCGCAGTTTAGAAGTAATTTCTCGAGAAATTACTTCTAAACTGCGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019675    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_005915.4-2519s1c1
Sequence:CCGGCCTAACTACTTGCTCGAAGATCTCGAGATCTTCGAGCAAGTAGTTAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019677    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_005915.4-1659s1c1
Sequence:CCGGCCCGATTCGATCTCTTCTTTACTCGAGTAAAGAAGAGATCGAATCGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019678    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005915.4-1142s1c1
Sequence:CCGGCCTACTATACATGGCAATGATCTCGAGATCATTGCCATGTATAGTAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019676    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005915.4-949s1c1
Sequence:CCGGCCTTTCTTATAGGCTGGTCTTCTCGAGAAGACCAGCCTATAAGAAAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275721    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 2 Clone ID:NM_005915.4-1142s21c1
Sequence:CCGGCCTACTATACATGGCAATGATCTCGAGATCATTGCCATGTATAGTAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275722    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_005915.4-738s21c1
Sequence:CCGGCCCGCAGTTTAGAAGTAATTTCTCGAGAAATTACTTCTAAACTGCGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275649    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_005915.4-2237s21c1
Sequence:CCGGTGCCGAATCTCTAACCTTATTCTCGAGAATAAGGTTAGAGATTCGGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275651    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005915.4-2954s21c1
Sequence:CCGGTCTACTGTACCCTGATTATTACTCGAGTAATAATCAGGGTACAGTAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275723    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_005915.4-1659s21c1
Sequence:CCGGCCCGATTCGATCTCTTCTTTACTCGAGTAAAGAAGAGATCGAATCGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008567
VALIDATED
MCM6 MISSION shRNA Bacterial Glycerol Stock
minichromosome maintenance complex component 6
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000124139    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_008567.1-2745s1c1
Sequence:CCGGCTATTGAAGTTGGAACCAAATCTCGAGATTTGGTTCCAACTTCAATAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124141    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008567.1-1337s1c1
Sequence:CCGGGCTGTCTATACCAGTGGCAAACTCGAGTTTGCCACTGGTATAGACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124142    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_008567.1-1055s1c1
Sequence:CCGGGCTGAGAGCATTAAGAACCAACTCGAGTTGGTTCTTAATGCTCTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124143    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_008567.1-2521s1c1
Sequence:CCGGCCTGGTAGTCAACCCTAACTACTCGAGTAGTTAGGGTTGACTACCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124140    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_008567.1-1611s1c1
Sequence:CCGGGCGGACACTATGACAGATCAACTCGAGTTGATCTGTCATAGTGTCCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008567
VALIDATED
MCM6 MISSION shRNA shRNA Plasmid DNA
minichromosome maintenance complex component 6
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000124139    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_008567.1-2745s1c1
Sequence:CCGGCTATTGAAGTTGGAACCAAATCTCGAGATTTGGTTCCAACTTCAATAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000124141    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008567.1-1337s1c1
Sequence:CCGGGCTGTCTATACCAGTGGCAAACTCGAGTTTGCCACTGGTATAGACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000124142    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_008567.1-1055s1c1
Sequence:CCGGGCTGAGAGCATTAAGAACCAACTCGAGTTGGTTCTTAATGCTCTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000124143    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_008567.1-2521s1c1
Sequence:CCGGCCTGGTAGTCAACCCTAACTACTCGAGTAGTTAGGGTTGACTACCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000124140    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_008567.1-1611s1c1
Sequence:CCGGGCGGACACTATGACAGATCAACTCGAGTTGATCTGTCATAGTGTCCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008567
VALIDATED
MCM6 MISSION shRNA Lentiviral Transduction Particles
minichromosome maintenance complex component 6
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000124139    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_008567.1-2745s1c1
Sequence:CCGGCTATTGAAGTTGGAACCAAATCTCGAGATTTGGTTCCAACTTCAATAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124141    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008567.1-1337s1c1
Sequence:CCGGGCTGTCTATACCAGTGGCAAACTCGAGTTTGCCACTGGTATAGACAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124142    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_008567.1-1055s1c1
Sequence:CCGGGCTGAGAGCATTAAGAACCAACTCGAGTTGGTTCTTAATGCTCTCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124143    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_008567.1-2521s1c1
Sequence:CCGGCCTGGTAGTCAACCCTAACTACTCGAGTAGTTAGGGTTGACTACCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124140    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_008567.1-1611s1c1
Sequence:CCGGGCGGACACTATGACAGATCAACTCGAGTTGATCTGTCATAGTGTCCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)