EMAIL THIS PAGE TO A FRIEND

MCM7

minichromosome maintenance complex component 7

72 Gene Product Result for
Synonyms: CDC47 MCM2 P1.1-MCM3 P1CDC47 P85MCM PNAS146
Gene ID:
Human(4176) Summary: The protein encoded by this gene is one of the highly conserved mini-chromosome maintenance proteins (MCM) that are essential for the initiation of eukaryotic genome replication. The hexameric protein complex formed by the MCM proteins is a key component of the pre-replication complex (pre_RC) and may be involved in the formation of replication forks and in the recruitment of other DNA replication related proteins. The MCM complex consisting of this protein and MCM2, 4 and 6 proteins possesses DNA helicase activity, and may act as a DNA unwinding enzyme. Cyclin D1-dependent kinase, CDK4, is found to associate with this protein, and may regulate the binding of this protein with the tumorsuppressor protein RB1/RB. Alternatively spliced transcript variants encoding distinct isoforms have been reported. [provided by RefSeq, Jul 2008]
Mouse(17220) minichromosome maintenance deficient 7 (S. cerevisiae)
Rat(288532) minichromosome maintenance complex component 7
Zebrafish(192333) MCM7 minichromosome maintenance deficient 7 (S. cerevisiae)
fruit fly(39014) Minichromosome maintenance 7
dog(479737) minichromosome maintenance complex component 7
domestic cat(101088383) minichromosome maintenance complex component 7
cow(539924) minichromosome maintenance complex component 7
Horse(100053690) minichromosome maintenance complex component 7
domestic guinea pig(100719227) minichromosome maintenance complex component 7
naked mole-rat(101724967) minichromosome maintenance complex component 7
Domestic Rabbit(100337896) minichromosome maintenance complex component 7
sheep(101108015) minichromosome maintenance complex component 7
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
AV36652 Anti-MCM7 (AB1) antibody produced in rabbit IgG fraction of antiserum human
immunohistochemistry, western blot pricing
AV36653 Anti-MCM7 (AB2) antibody produced in rabbit IgG fraction of antiserum human
western blot pricing
AV36667 Anti-MCM7 (AB3) antibody produced in rabbit IgG fraction of antiserum bovine, mouse, guinea pig, rabbit, rat, human, horse, dog
western blot pricing
HPA003898 Anti-MCM7 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution Antibody Enhanced Validation human, rat, mouse
immunofluorescence, immunohistochemistry, western blot pricing
SAB2101445 Anti-MCM7 antibody produced in rabbit affinity isolated antibody dog, rabbit, horse, human, guinea pig, bovine, rat
western blot pricing
PLA0042 Goat anti-MCM7 Antibody, Affinity Purified Powered by Bethyl Laboratories, Inc. mouse, human
proximity ligation assay, western blot pricing
M7931 Monoclonal Anti-Mcm7 antibody produced in mouse clone DCS-141, ascites fluid human, Xenopus
immunocytochemistry, immunoprecipitation (IP), western blot pricing
WH0004176M1 Monoclonal Anti-MCM7 antibody produced in mouse clone 6C2, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, proximity ligation assay, western blot pricing
SAB1404057 Monoclonal Anti-MCM7 antibody produced in mouse clone 1G1, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_008568 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008568 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008568 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_005916 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005916 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005916 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005916 Rosetta Predictions human pricing
NM_182776 Rosetta Predictions human pricing
NM_001004203 Rosetta Predictions rat pricing
NM_008568 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005916 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00071343 predicted 2410
2 SASI_Hs01_00071344 predicted 2386
3 SASI_Hs01_00071345 predicted 1835
4 SASI_Hs01_00071346 predicted 2081
5 SASI_Hs01_00071347 predicted 2281
6 SASI_Hs01_00071348 predicted 1625
7 SASI_Hs01_00071349 predicted 1242
8 SASI_Hs01_00071350 predicted 1211
9 SASI_Hs01_00071351 predicted 2420
10 SASI_Hs01_00071352 predicted 1263
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_182776 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00169433 predicted 2489
2 SASI_Hs01_00169434 predicted 2463
3 SASI_Hs01_00169435 predicted 1915
4 SASI_Hs01_00169436 predicted 2164
5 SASI_Hs01_00169437 predicted 2366
6 SASI_Hs01_00169438 predicted 1697
7 SASI_Hs01_00169439 predicted 1323
8 SASI_Hs01_00169440 predicted 1289
9 SASI_Hs01_00169441 predicted 2500
10 SASI_Hs01_00169442 predicted 1337
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001004203 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00107616 predicted 929
2 SASI_Rn01_00107617 predicted 276
3 SASI_Rn01_00107618 predicted 1025
4 SASI_Rn01_00107619 predicted 443
5 SASI_Rn01_00107620 predicted 521
6 SASI_Rn01_00107621 predicted 455
7 SASI_Rn01_00107622 predicted 1481
8 SASI_Rn01_00107623 predicted 460
9 SASI_Rn02_00198180 predicted 1562
10 SASI_Rn02_00198181 predicted 1191
11 SASI_Rn01_00107615 predicted 661
12 SASI_Rn01_00107624 predicted 662
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008568 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00314174 predicted 553
2 SASI_Mm02_00314175 predicted 376
3 SASI_Mm02_00314176 predicted 1884
4 SASI_Mm02_00314177 predicted 2004
5 SASI_Mm02_00314178 predicted 493
6 SASI_Mm02_00314179 predicted 1117
7 SASI_Mm02_00314180 predicted 1751
8 SASI_Mm02_00314181 predicted 1021
9 SASI_Mm02_00314182 predicted 226
10 SASI_Mm02_00314183 predicted 1640
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008568
VALIDATED
MCM7 MISSION shRNA Bacterial Glycerol Stock
minichromosome maintenance complex component 7
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000339971    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008568.2-499s21c1
Sequence:CCGGGCGAAGATTTGAGTTGTATTTCTCGAGAAATACAACTCAAATCTTCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000339901    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008568.2-478s21c1
Sequence:CCGGCCAGTATCCTTCTGAACTCATCTCGAGATGAGTTCAGAAGGATACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000339972    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008568.2-2217s21c1
Sequence:CCGGTAAATGTCTGGCAGGTTAATACTCGAGTATTAACCTGCCAGACATTTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000339973    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008568.2-1572s21c1
Sequence:CCGGATCCTGCCTACGGCCGATATACTCGAGTATATCGGCCGTAGGCAGGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173156    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008568.1-478s1c1
Sequence:CCGGCCAGTATCCTTCTGAACTCATCTCGAGATGAGTTCAGAAGGATACTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175088    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008568.1-499s1c1
Sequence:CCGGGCGAAGATTTGAGTTGTATTTCTCGAGAAATACAACTCAAATCTTCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175473    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008568.1-496s1c1
Sequence:CCGGCATGCGAAGATTTGAGTTGTACTCGAGTACAACTCAAATCTTCGCATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193621    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008568.1-1771s1c1
Sequence:CCGGCATGAAACTTATGAGACGGTACTCGAGTACCGTCTCATAAGTTTCATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174880    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008568.1-1988s1c1
Sequence:CCGGGAAGATGTAAATGAAGCCATACTCGAGTATGGCTTCATTTACATCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175908    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008568.1-383s1c1
Sequence:CCGGGTGGTGAATAAGGATGTCTTACTCGAGTAAGACATCCTTATTCACCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000339904    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008568.2-294s21c1
Sequence:CCGGTCGACTCAATTTGCGAGAATGCTCGAGCATTCTCGCAAATTGAGTCGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008568
VALIDATED
MCM7 MISSION shRNA shRNA Plasmid DNA
minichromosome maintenance complex component 7
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000339971    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008568.2-499s21c1
Sequence:CCGGGCGAAGATTTGAGTTGTATTTCTCGAGAAATACAACTCAAATCTTCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000339901    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008568.2-478s21c1
Sequence:CCGGCCAGTATCCTTCTGAACTCATCTCGAGATGAGTTCAGAAGGATACTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000339972    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008568.2-2217s21c1
Sequence:CCGGTAAATGTCTGGCAGGTTAATACTCGAGTATTAACCTGCCAGACATTTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000339973    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008568.2-1572s21c1
Sequence:CCGGATCCTGCCTACGGCCGATATACTCGAGTATATCGGCCGTAGGCAGGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000173156    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008568.1-478s1c1
Sequence:CCGGCCAGTATCCTTCTGAACTCATCTCGAGATGAGTTCAGAAGGATACTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000175088    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008568.1-499s1c1
Sequence:CCGGGCGAAGATTTGAGTTGTATTTCTCGAGAAATACAACTCAAATCTTCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000175473    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008568.1-496s1c1
Sequence:CCGGCATGCGAAGATTTGAGTTGTACTCGAGTACAACTCAAATCTTCGCATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000193621    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008568.1-1771s1c1
Sequence:CCGGCATGAAACTTATGAGACGGTACTCGAGTACCGTCTCATAAGTTTCATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000174880    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008568.1-1988s1c1
Sequence:CCGGGAAGATGTAAATGAAGCCATACTCGAGTATGGCTTCATTTACATCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000175908    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008568.1-383s1c1
Sequence:CCGGGTGGTGAATAAGGATGTCTTACTCGAGTAAGACATCCTTATTCACCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000339904    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008568.2-294s21c1
Sequence:CCGGTCGACTCAATTTGCGAGAATGCTCGAGCATTCTCGCAAATTGAGTCGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008568
VALIDATED
MCM7 MISSION shRNA Lentiviral Transduction Particles
minichromosome maintenance complex component 7
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000339971    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008568.2-499s21c1
Sequence:CCGGGCGAAGATTTGAGTTGTATTTCTCGAGAAATACAACTCAAATCTTCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000339901    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008568.2-478s21c1
Sequence:CCGGCCAGTATCCTTCTGAACTCATCTCGAGATGAGTTCAGAAGGATACTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000339972    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008568.2-2217s21c1
Sequence:CCGGTAAATGTCTGGCAGGTTAATACTCGAGTATTAACCTGCCAGACATTTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000339973    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008568.2-1572s21c1
Sequence:CCGGATCCTGCCTACGGCCGATATACTCGAGTATATCGGCCGTAGGCAGGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173156    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008568.1-478s1c1
Sequence:CCGGCCAGTATCCTTCTGAACTCATCTCGAGATGAGTTCAGAAGGATACTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175088    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008568.1-499s1c1
Sequence:CCGGGCGAAGATTTGAGTTGTATTTCTCGAGAAATACAACTCAAATCTTCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175473    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008568.1-496s1c1
Sequence:CCGGCATGCGAAGATTTGAGTTGTACTCGAGTACAACTCAAATCTTCGCATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193621    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008568.1-1771s1c1
Sequence:CCGGCATGAAACTTATGAGACGGTACTCGAGTACCGTCTCATAAGTTTCATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174880    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008568.1-1988s1c1
Sequence:CCGGGAAGATGTAAATGAAGCCATACTCGAGTATGGCTTCATTTACATCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175908    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008568.1-383s1c1
Sequence:CCGGGTGGTGAATAAGGATGTCTTACTCGAGTAAGACATCCTTATTCACCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000339904    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008568.2-294s21c1
Sequence:CCGGTCGACTCAATTTGCGAGAATGCTCGAGCATTCTCGCAAATTGAGTCGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005916
VALIDATED
MCM7 MISSION shRNA Bacterial Glycerol Stock
minichromosome maintenance complex component 7
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000330416    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_005916.3-2383s21c1
Sequence:CCGGGTGGAGAAAGAAGATGTGAATCTCGAGATTCACATCTTCTTTCTCCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000330348    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005916.3-903s21c1
Sequence:CCGGGCGCAGATTTGAGCTGTATTTCTCGAGAAATACAGCTCAAATCTGCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000330417    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_005916.3-689s21c1
Sequence:CCGGCCGAGTTGGTGGACTCAATTTCTCGAGAAATTGAGTCCACCAACTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019720    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005916.3-2290s1c1
Sequence:CCGGGCTAGTAAGGATGCCACCTATCTCGAGATAGGTGGCATCCTTACTAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019723    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_005916.3-2383s1c1
Sequence:CCGGGTGGAGAAAGAAGATGTGAATCTCGAGATTCACATCTTCTTTCTCCACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019722    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005916.3-697s1c1
Sequence:CCGGGTGGACTCAATTTGTGAGAATCTCGAGATTCTCACAAATTGAGTCCACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000330349    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005916.3-1545s21c1
Sequence:CCGGCGGGCATGAAGATGTGAAGAACTCGAGTTCTTCACATCTTCATGCCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019719    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005916.3-903s1c1
Sequence:CCGGGCGCAGATTTGAGCTGTATTTCTCGAGAAATACAGCTCAAATCTGCGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005916
VALIDATED
MCM7 MISSION shRNA shRNA Plasmid DNA
minichromosome maintenance complex component 7
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000330416    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_005916.3-2383s21c1
Sequence:CCGGGTGGAGAAAGAAGATGTGAATCTCGAGATTCACATCTTCTTTCTCCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000330348    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005916.3-903s21c1
Sequence:CCGGGCGCAGATTTGAGCTGTATTTCTCGAGAAATACAGCTCAAATCTGCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000330417    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_005916.3-689s21c1
Sequence:CCGGCCGAGTTGGTGGACTCAATTTCTCGAGAAATTGAGTCCACCAACTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000019720    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005916.3-2290s1c1
Sequence:CCGGGCTAGTAAGGATGCCACCTATCTCGAGATAGGTGGCATCCTTACTAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000019723    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_005916.3-2383s1c1
Sequence:CCGGGTGGAGAAAGAAGATGTGAATCTCGAGATTCACATCTTCTTTCTCCACTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000019722    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005916.3-697s1c1
Sequence:CCGGGTGGACTCAATTTGTGAGAATCTCGAGATTCTCACAAATTGAGTCCACTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000330349    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005916.3-1545s21c1
Sequence:CCGGCGGGCATGAAGATGTGAAGAACTCGAGTTCTTCACATCTTCATGCCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000019719    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005916.3-903s1c1
Sequence:CCGGGCGCAGATTTGAGCTGTATTTCTCGAGAAATACAGCTCAAATCTGCGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005916
VALIDATED
MCM7 MISSION shRNA Lentiviral Transduction Particles
minichromosome maintenance complex component 7
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000330416    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_005916.3-2383s21c1
Sequence:CCGGGTGGAGAAAGAAGATGTGAATCTCGAGATTCACATCTTCTTTCTCCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000330348    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005916.3-903s21c1
Sequence:CCGGGCGCAGATTTGAGCTGTATTTCTCGAGAAATACAGCTCAAATCTGCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000330417    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_005916.3-689s21c1
Sequence:CCGGCCGAGTTGGTGGACTCAATTTCTCGAGAAATTGAGTCCACCAACTCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019720    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005916.3-2290s1c1
Sequence:CCGGGCTAGTAAGGATGCCACCTATCTCGAGATAGGTGGCATCCTTACTAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019723    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_005916.3-2383s1c1
Sequence:CCGGGTGGAGAAAGAAGATGTGAATCTCGAGATTCACATCTTCTTTCTCCACTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019722    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005916.3-697s1c1
Sequence:CCGGGTGGACTCAATTTGTGAGAATCTCGAGATTCTCACAAATTGAGTCCACTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000330349    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005916.3-1545s21c1
Sequence:CCGGCGGGCATGAAGATGTGAAGAACTCGAGTTCTTCACATCTTCATGCCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019719    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005916.3-903s1c1
Sequence:CCGGGCGCAGATTTGAGCTGTATTTCTCGAGAAATACAGCTCAAATCTGCGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)