EMAIL THIS PAGE TO A FRIEND

MCM8

minichromosome maintenance complex component 8

64 Gene Product Result for
Synonyms: C20orf154 dJ967N21.5
Gene ID:
Human(84515) Summary: The protein encoded by this gene is one of the highly conserved mini-chromosome maintenance proteins (MCM) that are essential for the initiation of eukaryotic genome replication. The hexameric protein complex formed by the MCM proteins is a key component of the pre-replication complex (pre_RC) and may be involved in the formation of replication forks and in the recruitment of other DNA replication related proteins. This protein contains the central domain that is conserved among the MCM proteins. This protein has been shown to co-immunoprecipitate with MCM4, 6 and 7, which suggests that it may interact with other MCM proteins and play a role in DNA replication. Alternatively spliced transcript variants encoding distinct isoforms have been described. [provided by RefSeq, Jul 2008]
Mouse(66634) minichromosome maintenance deficient 8 (S. cerevisiae)
Rat(296178) minichromosome maintenance complex component 8
sheep(101116498) minichromosome maintenance complex component 8
Domestic Rabbit(100337967) minichromosome maintenance complex component 8
naked mole-rat(101719798) minichromosome maintenance complex component 8
domestic guinea pig(100734936) minichromosome maintenance complex component 8
Thale Cress(820123) minichromosome maintenance 8
domestic cat(101088566) minichromosome maintenance complex component 8
cow(507507) minichromosome maintenance complex component 8
Horse(100065561) minichromosome maintenance complex component 8
dog(477163) minichromosome maintenance complex component 8
chicken(421314) minichromosome maintenance complex component 8
Gene Class: ATPase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
AV36668 Anti-MCM8 antibody produced in rabbit affinity isolated antibody rabbit, mouse, rat, human, guinea pig, horse, bovine, canine
immunohistochemistry, western blot pricing
AV36669 Anti-MCM8 antibody produced in rabbit IgG fraction of antiserum guinea pig, canine, human, horse, rat, rabbit, bovine, mouse
western blot pricing
SAB2101446 Anti-MCM8 antibody produced in rabbit affinity isolated antibody guinea pig, mouse, human, canine, rat, horse, rabbit, bovine
western blot pricing
HPA045141 Anti-MCM8 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody human
immunofluorescence, western blot pricing
SAB2104325 Anti-MCM8, (N-terminal) antibody produced in rabbit affinity isolated antibody rat, bovine, mouse, canine, human, horse, guinea pig, rabbit,
western blot pricing
WH0084515M2 Monoclonal Anti-MCM8 antibody produced in mouse clone 1F9, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_032485 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032485 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032485 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_025676 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025676 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025676 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032485 Rosetta Predictions human pricing
NM_182802 Rosetta Predictions human pricing
NM_001106514 Rosetta Predictions rat pricing
NM_025676 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032485 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00175186 predicted 2123
2 SASI_Hs01_00175187 predicted 1123
3 SASI_Hs01_00175188 predicted 828
4 SASI_Hs01_00175189 predicted 2035
5 SASI_Hs01_00175190 predicted 2726
6 SASI_Hs01_00175191 predicted 845
7 SASI_Hs01_00175192 predicted 964
8 SASI_Hs01_00175193 predicted 947
9 SASI_Hs01_00175194 predicted 2249
10 SASI_Hs01_00175195 predicted 2716
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_182802 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00037499 predicted 2137
2 SASI_Hs01_00037500 predicted 1174
3 SASI_Hs01_00037501 predicted 884
4 SASI_Hs01_00037502 predicted 2045
5 SASI_Hs01_00037503 predicted 2732
6 SASI_Hs01_00037504 predicted 902
7 SASI_Hs01_00037505 predicted 1023
8 SASI_Hs01_00037506 predicted 997
9 SASI_Hs01_00037507 predicted 2257
10 SASI_Hs01_00037508 predicted 2724
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106514 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00219708 predicted 890
2 SASI_Rn02_00219709 predicted 1248
3 SASI_Rn02_00219710 predicted 2191
4 SASI_Rn02_00219711 predicted 2282
5 SASI_Rn02_00219712 predicted 660
6 SASI_Rn02_00219713 predicted 565
7 SASI_Rn02_00219714 predicted 425
8 SASI_Rn02_00219715 predicted 1001
9 SASI_Rn02_00219716 predicted 725
10 SASI_Rn02_00219717 predicted 2148
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025676 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00094533 predicted 1803
2 SASI_Mm01_00094534 predicted 1866
3 SASI_Mm01_00094535 predicted 524
4 SASI_Mm02_00328821 predicted 2068
5 SASI_Mm01_00094536 predicted 1074
6 SASI_Mm02_00328822 predicted 1711
7 SASI_Mm01_00094538 predicted 1300
8 SASI_Mm01_00094539 predicted 361
9 SASI_Mm01_00094540 predicted 579
10 SASI_Mm01_00094541 predicted 2285
11 SASI_Mm01_00094532 predicted 459
12 SASI_Mm01_00094537 predicted 1852
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032485
VALIDATED
MCM8 MISSION shRNA Bacterial Glycerol Stock
minichromosome maintenance complex component 8
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000020274    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032485.4-1985s1c1
Sequence:CCGGGCAAAGTATTAGTCTTGCTAACTCGAGTTAGCAAGACTAATACTTTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020276    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_032485.4-648s1c1
Sequence:CCGGCCTTTGATTGAGAAGATTCAACTCGAGTTGAATCTTCTCAATCAAAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020278    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_032485.4-2253s1c1
Sequence:CCGGGCTCGTATGAATAGTCAAGATCTCGAGATCTTGACTATTCATACGAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020277    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_032485.4-1351s1c1
Sequence:CCGGCGGGAGACACAGTGACTATTACTCGAGTAATAGTCACTGTGTCTCCCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020275    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_032485.4-2586s1c1
Sequence:CCGGGCTGAGGATATAGTGGAAATTCTCGAGAATTTCCACTATATCCTCAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000285482    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_032485.4-584s21c1
Sequence:CCGGGGATCGATTCATACCATATAACTCGAGTTATATGGTATGAATCGATCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276011    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_032485.4-2253s21c1
Sequence:CCGGGCTCGTATGAATAGTCAAGATCTCGAGATCTTGACTATTCATACGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276010    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032485.4-1351s21c1
Sequence:CCGGCGGGAGACACAGTGACTATTACTCGAGTAATAGTCACTGTGTCTCCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276065    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_032485.4-648s21c1
Sequence:CCGGCCTTTGATTGAGAAGATTCAACTCGAGTTGAATCTTCTCAATCAAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276064    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_032485.4-2916s21c1
Sequence:CCGGTTAGGGCCTCCTGGGTTTATTCTCGAGAATAAACCCAGGAGGCCCTAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032485
VALIDATED
MCM8 MISSION shRNA shRNA Plasmid DNA
minichromosome maintenance complex component 8
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000020274    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032485.4-1985s1c1
Sequence:CCGGGCAAAGTATTAGTCTTGCTAACTCGAGTTAGCAAGACTAATACTTTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000020276    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_032485.4-648s1c1
Sequence:CCGGCCTTTGATTGAGAAGATTCAACTCGAGTTGAATCTTCTCAATCAAAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000020278    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_032485.4-2253s1c1
Sequence:CCGGGCTCGTATGAATAGTCAAGATCTCGAGATCTTGACTATTCATACGAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000020277    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_032485.4-1351s1c1
Sequence:CCGGCGGGAGACACAGTGACTATTACTCGAGTAATAGTCACTGTGTCTCCCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000020275    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_032485.4-2586s1c1
Sequence:CCGGGCTGAGGATATAGTGGAAATTCTCGAGAATTTCCACTATATCCTCAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000285482    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_032485.4-584s21c1
Sequence:CCGGGGATCGATTCATACCATATAACTCGAGTTATATGGTATGAATCGATCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000276011    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_032485.4-2253s21c1
Sequence:CCGGGCTCGTATGAATAGTCAAGATCTCGAGATCTTGACTATTCATACGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000276010    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032485.4-1351s21c1
Sequence:CCGGCGGGAGACACAGTGACTATTACTCGAGTAATAGTCACTGTGTCTCCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000276065    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_032485.4-648s21c1
Sequence:CCGGCCTTTGATTGAGAAGATTCAACTCGAGTTGAATCTTCTCAATCAAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000276064    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_032485.4-2916s21c1
Sequence:CCGGTTAGGGCCTCCTGGGTTTATTCTCGAGAATAAACCCAGGAGGCCCTAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032485
VALIDATED
MCM8 MISSION shRNA Lentiviral Transduction Particles
minichromosome maintenance complex component 8
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000020274    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032485.4-1985s1c1
Sequence:CCGGGCAAAGTATTAGTCTTGCTAACTCGAGTTAGCAAGACTAATACTTTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020276    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_032485.4-648s1c1
Sequence:CCGGCCTTTGATTGAGAAGATTCAACTCGAGTTGAATCTTCTCAATCAAAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020278    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_032485.4-2253s1c1
Sequence:CCGGGCTCGTATGAATAGTCAAGATCTCGAGATCTTGACTATTCATACGAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020277    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_032485.4-1351s1c1
Sequence:CCGGCGGGAGACACAGTGACTATTACTCGAGTAATAGTCACTGTGTCTCCCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020275    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_032485.4-2586s1c1
Sequence:CCGGGCTGAGGATATAGTGGAAATTCTCGAGAATTTCCACTATATCCTCAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000285482    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_032485.4-584s21c1
Sequence:CCGGGGATCGATTCATACCATATAACTCGAGTTATATGGTATGAATCGATCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276011    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_032485.4-2253s21c1
Sequence:CCGGGCTCGTATGAATAGTCAAGATCTCGAGATCTTGACTATTCATACGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276010    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032485.4-1351s21c1
Sequence:CCGGCGGGAGACACAGTGACTATTACTCGAGTAATAGTCACTGTGTCTCCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276065    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_032485.4-648s21c1
Sequence:CCGGCCTTTGATTGAGAAGATTCAACTCGAGTTGAATCTTCTCAATCAAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276064    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_032485.4-2916s21c1
Sequence:CCGGTTAGGGCCTCCTGGGTTTATTCTCGAGAATAAACCCAGGAGGCCCTAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025676
VALIDATED
MCM8 MISSION shRNA Bacterial Glycerol Stock
minichromosome maintenance complex component 8
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000123929    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025676.2-2705s1c1
Sequence:CCGGCCAGAAGAGTAAGAAGAGTAACTCGAGTTACTCTTCTTACTCTTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123932    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025676.2-521s1c1
Sequence:CCGGGCTGGCAATACATCAGGTATTCTCGAGAATACCTGATGTATTGCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123933    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025676.2-972s1c1
Sequence:CCGGCCTCGGACGATAGAATGTGAACTCGAGTTCACATTCTATCGTCCGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123930    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025676.2-975s1c1
Sequence:CCGGCGGACGATAGAATGTGAACTTCTCGAGAAGTTCACATTCTATCGTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123931    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025676.2-1658s1c1
Sequence:CCGGGCAGAGTATTAGCCTTGCGAACTCGAGTTCGCAAGGCTAATACTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025676
VALIDATED
MCM8 MISSION shRNA shRNA Plasmid DNA
minichromosome maintenance complex component 8
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000123929    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025676.2-2705s1c1
Sequence:CCGGCCAGAAGAGTAAGAAGAGTAACTCGAGTTACTCTTCTTACTCTTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000123932    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025676.2-521s1c1
Sequence:CCGGGCTGGCAATACATCAGGTATTCTCGAGAATACCTGATGTATTGCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000123933    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025676.2-972s1c1
Sequence:CCGGCCTCGGACGATAGAATGTGAACTCGAGTTCACATTCTATCGTCCGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000123930    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025676.2-975s1c1
Sequence:CCGGCGGACGATAGAATGTGAACTTCTCGAGAAGTTCACATTCTATCGTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000123931    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025676.2-1658s1c1
Sequence:CCGGGCAGAGTATTAGCCTTGCGAACTCGAGTTCGCAAGGCTAATACTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025676
VALIDATED
MCM8 MISSION shRNA Lentiviral Transduction Particles
minichromosome maintenance complex component 8
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000123929    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025676.2-2705s1c1
Sequence:CCGGCCAGAAGAGTAAGAAGAGTAACTCGAGTTACTCTTCTTACTCTTCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123932    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025676.2-521s1c1
Sequence:CCGGGCTGGCAATACATCAGGTATTCTCGAGAATACCTGATGTATTGCCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123933    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025676.2-972s1c1
Sequence:CCGGCCTCGGACGATAGAATGTGAACTCGAGTTCACATTCTATCGTCCGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123930    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025676.2-975s1c1
Sequence:CCGGCGGACGATAGAATGTGAACTTCTCGAGAAGTTCACATTCTATCGTCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123931    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025676.2-1658s1c1
Sequence:CCGGGCAGAGTATTAGCCTTGCGAACTCGAGTTCGCAAGGCTAATACTCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)