EMAIL THIS PAGE TO A FRIEND

MCM9

minichromosome maintenance complex component 9

37 Gene Product Result for
Synonyms: C6orf61 MCMDC1 dJ329L24.1 dJ329L24.3
UniProtKB ID: Q9NXL9, B4DR30, B9DI77, Q2KHJ0, Q8N5S5, Q9HCV5
Gene ID:
Human(254394) Summary: The protein encoded by this gene is a member of the mini-chromosome maintenance (MCM) protein family that are essential for the initiation of eukaryotic genome replication. Binding of this protein to chromatin has been shown to be a pre-requisite for recruiting the MCM2-7 helicase to DNA replication origins. This protein also binds, and is a positive regulator of, the chromatin licensing and DNA replication factor 1, CDT1. [provided by RefSeq, Nov 2010]
Mouse(71567) minichromosome maintenance complex component 9
Zebrafish(555610) minichromosome maintenance complex component 9
chicken(100857742) minichromosome maintenance complex component 9
cow(100139498) minichromosome maintenance complex component 9
Horse(100072839) minichromosome maintenance complex component 9
domestic cat(101098953) minichromosome maintenance complex component 9
dog(484104) minichromosome maintenance complex component 9
Thale Cress(815890) minichromosome maintenance 9
domestic guinea pig(100733089) minichromosome maintenance complex component 9
naked mole-rat(101698921) minichromosome maintenance complex component 9
Domestic Rabbit(100340330) minichromosome maintenance complex component 9
sheep(101123472) minichromosome maintenance complex component 9
Gene Class: ATPase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_153255 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_153255 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_153255 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_027830 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027830 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027830 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_153255 Rosetta Predictions human pricing
NM_027830 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153255 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00041743 predicted 1445
2 SASI_Hs01_00041744 predicted 1053
3 SASI_Hs01_00041745 predicted 1207
4 SASI_Hs01_00041746 predicted 368
5 SASI_Hs01_00041747 predicted 1496
6 SASI_Hs01_00041749 predicted 736
7 SASI_Hs02_00367120 predicted 1180
8 SASI_Hs01_00041750 predicted 934
9 SASI_Hs01_00041751 predicted 1150
10 SASI_Hs02_00367121 predicted 1398
11 SASI_Hs01_00041742 predicted 1433
12 SASI_Hs01_00041748 predicted 885
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027830 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00151424 predicted 1206
2 SASI_Mm01_00151426 predicted 3147
3 SASI_Mm01_00151427 predicted 567
4 SASI_Mm02_00332782 predicted 2696
5 SASI_Mm01_00151428 predicted 2614
6 SASI_Mm01_00151429 predicted 2679
7 SASI_Mm01_00151430 predicted 2806
8 SASI_Mm01_00151431 predicted 2162
9 SASI_Mm01_00151432 predicted 1754
10 SASI_Mm02_00332783 predicted 2713
11 SASI_Mm01_00151425 predicted 1959
12 SASI_Mm01_00151433 predicted 3165
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153255
VALIDATED
MCM9 MISSION shRNA Bacterial Glycerol Stock
minichromosome maintenance complex component 9
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000430447    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153255.3-448s21c1
Sequence:CCGGCCAGTGAAGTGCTTACAATTTCTCGAGAAATTGTAAGCACTTCACTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429370    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153255.3-309s21c1
Sequence:CCGGTATGTTTCGGAATACCATAAGCTCGAGCTTATGGTATTCCGAAACATATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418860    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153255.3-372s21c1
Sequence:CCGGCATTACCCAGTTGTGGTTAATCTCGAGATTAACCACAACTGGGTAATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423740    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153255.3-1055s21c1
Sequence:CCGGAGCAAATTACATCCAAGTAAACTCGAGTTTACTTGGATGTAATTTGCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156219    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153255.2-1363s1c1
Sequence:CCGGCCACAGGAATTGGATCTACTACTCGAGTAGTAGATCCAATTCCTGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154982    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_153255.2-665s1c1
Sequence:CCGGGCGGGATTACATGTGTAACAACTCGAGTTGTTACACATGTAATCCCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150721    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153255.2-666s1c1
Sequence:CCGGCGGGATTACATGTGTAACAAACTCGAGTTTGTTACACATGTAATCCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156814    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153255.2-1171s1c1
Sequence:CCGGGCCCTCAAGTGTTTGGAATGTCTCGAGACATTCCAAACACTTGAGGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153255
VALIDATED
MCM9 MISSION shRNA shRNA Plasmid DNA
minichromosome maintenance complex component 9
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000430447    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153255.3-448s21c1
Sequence:CCGGCCAGTGAAGTGCTTACAATTTCTCGAGAAATTGTAAGCACTTCACTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000429370    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153255.3-309s21c1
Sequence:CCGGTATGTTTCGGAATACCATAAGCTCGAGCTTATGGTATTCCGAAACATATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000418860    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153255.3-372s21c1
Sequence:CCGGCATTACCCAGTTGTGGTTAATCTCGAGATTAACCACAACTGGGTAATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000423740    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153255.3-1055s21c1
Sequence:CCGGAGCAAATTACATCCAAGTAAACTCGAGTTTACTTGGATGTAATTTGCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000156219    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153255.2-1363s1c1
Sequence:CCGGCCACAGGAATTGGATCTACTACTCGAGTAGTAGATCCAATTCCTGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000154982    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_153255.2-665s1c1
Sequence:CCGGGCGGGATTACATGTGTAACAACTCGAGTTGTTACACATGTAATCCCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000150721    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153255.2-666s1c1
Sequence:CCGGCGGGATTACATGTGTAACAAACTCGAGTTTGTTACACATGTAATCCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000156814    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153255.2-1171s1c1
Sequence:CCGGGCCCTCAAGTGTTTGGAATGTCTCGAGACATTCCAAACACTTGAGGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153255
VALIDATED
MCM9 MISSION shRNA Lentiviral Transduction Particles
minichromosome maintenance complex component 9
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000430447    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153255.3-448s21c1
Sequence:CCGGCCAGTGAAGTGCTTACAATTTCTCGAGAAATTGTAAGCACTTCACTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429370    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153255.3-309s21c1
Sequence:CCGGTATGTTTCGGAATACCATAAGCTCGAGCTTATGGTATTCCGAAACATATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418860    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153255.3-372s21c1
Sequence:CCGGCATTACCCAGTTGTGGTTAATCTCGAGATTAACCACAACTGGGTAATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423740    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153255.3-1055s21c1
Sequence:CCGGAGCAAATTACATCCAAGTAAACTCGAGTTTACTTGGATGTAATTTGCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156219    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153255.2-1363s1c1
Sequence:CCGGCCACAGGAATTGGATCTACTACTCGAGTAGTAGATCCAATTCCTGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154982    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_153255.2-665s1c1
Sequence:CCGGGCGGGATTACATGTGTAACAACTCGAGTTGTTACACATGTAATCCCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150721    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153255.2-666s1c1
Sequence:CCGGCGGGATTACATGTGTAACAAACTCGAGTTTGTTACACATGTAATCCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156814    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153255.2-1171s1c1
Sequence:CCGGGCCCTCAAGTGTTTGGAATGTCTCGAGACATTCCAAACACTTGAGGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027830
MCM9 MISSION shRNA Bacterial Glycerol Stock
minichromosome maintenance complex component 9
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000241263    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027830.2-882s21c1
Sequence:CCGGCTTGGAGTTCGAGCGGGATTACTCGAGTAATCCCGCTCGAACTCCAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241260    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027830.2-523s21c1
Sequence:CCGGGAGTACCATAAGAACGATATTCTCGAGAATATCGTTCTTATGGTACTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000215811    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027830.2-1698s1c1
Sequence:CCGGCTGCTGTATTGACGAATTTAACTCGAGTTAAATTCGTCAATACAGCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241261    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027830.2-2874s21c1
Sequence:CCGGCTTACGGTCTCACGGTGTTAACTCGAGTTAACACCGTGAGACCGTAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241259    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027830.2-973s21c1
Sequence:CCGGCCATCGTCATGTCCAAGTTTACTCGAGTAAACTTGGACATGACGATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241262    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027830.2-1697s21c1
Sequence:CCGGTCTGCTGTATTGACGAATTTACTCGAGTAAATTCGTCAATACAGCAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192041    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027830.1-901s1c1
Sequence:CCGGCCACGGTCTATGAAAGTTATTCTCGAGAATAACTTTCATAGACCGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191732    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027830.1-322s1c1
Sequence:CCGGGATATTCTTCTGATCCTGAAACTCGAGTTTCAGGATCAGAAGAATATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190394    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027830.1-757s1c1
Sequence:CCGGCCATCGTCATGTCCAAGTTTACTCGAGTAAACTTGGACATGACGATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027830
MCM9 MISSION shRNA shRNA Plasmid DNA
minichromosome maintenance complex component 9
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000241263    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027830.2-882s21c1
Sequence:CCGGCTTGGAGTTCGAGCGGGATTACTCGAGTAATCCCGCTCGAACTCCAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000241260    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027830.2-523s21c1
Sequence:CCGGGAGTACCATAAGAACGATATTCTCGAGAATATCGTTCTTATGGTACTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000215811    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027830.2-1698s1c1
Sequence:CCGGCTGCTGTATTGACGAATTTAACTCGAGTTAAATTCGTCAATACAGCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000241261    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027830.2-2874s21c1
Sequence:CCGGCTTACGGTCTCACGGTGTTAACTCGAGTTAACACCGTGAGACCGTAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000241259    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027830.2-973s21c1
Sequence:CCGGCCATCGTCATGTCCAAGTTTACTCGAGTAAACTTGGACATGACGATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000241262    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027830.2-1697s21c1
Sequence:CCGGTCTGCTGTATTGACGAATTTACTCGAGTAAATTCGTCAATACAGCAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000192041    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027830.1-901s1c1
Sequence:CCGGCCACGGTCTATGAAAGTTATTCTCGAGAATAACTTTCATAGACCGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000191732    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027830.1-322s1c1
Sequence:CCGGGATATTCTTCTGATCCTGAAACTCGAGTTTCAGGATCAGAAGAATATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000190394    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027830.1-757s1c1
Sequence:CCGGCCATCGTCATGTCCAAGTTTACTCGAGTAAACTTGGACATGACGATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027830
MCM9 MISSION shRNA Lentiviral Transduction Particles
minichromosome maintenance complex component 9
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000241263    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027830.2-882s21c1
Sequence:CCGGCTTGGAGTTCGAGCGGGATTACTCGAGTAATCCCGCTCGAACTCCAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241260    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027830.2-523s21c1
Sequence:CCGGGAGTACCATAAGAACGATATTCTCGAGAATATCGTTCTTATGGTACTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000215811    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027830.2-1698s1c1
Sequence:CCGGCTGCTGTATTGACGAATTTAACTCGAGTTAAATTCGTCAATACAGCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241261    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027830.2-2874s21c1
Sequence:CCGGCTTACGGTCTCACGGTGTTAACTCGAGTTAACACCGTGAGACCGTAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241259    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027830.2-973s21c1
Sequence:CCGGCCATCGTCATGTCCAAGTTTACTCGAGTAAACTTGGACATGACGATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241262    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027830.2-1697s21c1
Sequence:CCGGTCTGCTGTATTGACGAATTTACTCGAGTAAATTCGTCAATACAGCAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192041    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027830.1-901s1c1
Sequence:CCGGCCACGGTCTATGAAAGTTATTCTCGAGAATAACTTTCATAGACCGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191732    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027830.1-322s1c1
Sequence:CCGGGATATTCTTCTGATCCTGAAACTCGAGTTTCAGGATCAGAAGAATATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190394    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027830.1-757s1c1
Sequence:CCGGCCATCGTCATGTCCAAGTTTACTCGAGTAAACTTGGACATGACGATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)