EMAIL THIS PAGE TO A FRIEND

MCMBP

minichromosome maintenance complex binding protein

62 Gene Product Result for
Synonyms: C10orf119 MCM-BP
UniProtKB ID: Q9BTE3, B3KSP7, Q6IA56, Q9BVT9, Q9H916
Gene ID:
Human(79892) Summary: This gene encodes a protein which is a component of the hexameric minichromosome maintenance (MCM) complex which regulates initiation and elongation of DNA. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2012]
Mouse(210711) MCM (minichromosome maintenance deficient) binding protein
sheep(101108791) minichromosome maintenance complex binding protein
naked mole-rat(101715148) minichromosome maintenance complex binding protein
domestic guinea pig(100715558) minichromosome maintenance complex binding protein
Zebrafish(321119) minichromosome maintenance complex binding protein
cow(514863) minichromosome maintenance complex binding protein
Horse(100065714) minichromosome maintenance complex binding protein
domestic cat(101089966) minichromosome maintenance complex binding protein
dog(612966) minichromosome maintenance complex binding protein
chicken(423933) minichromosome maintenance complex binding protein
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_145955 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_145955 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_145955 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_024834 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024834 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024834 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024834 Rosetta Predictions human pricing
NM_145955 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024834 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00017664 predicted 921
2 SASI_Hs01_00017665 predicted 2149
3 SASI_Hs01_00017666 predicted 498
4 SASI_Hs01_00017667 predicted 907
5 SASI_Hs01_00017668 predicted 1644
6 SASI_Hs01_00017670 predicted 488
7 SASI_Hs01_00017671 predicted 660
8 SASI_Hs02_00357399 predicted 809
9 SASI_Hs01_00017672 predicted 723
10 SASI_Hs01_00017673 predicted 949
11 SASI_Hs01_00017669 predicted 607
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145955 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00119238 predicted 1334
2 SASI_Mm01_00119239 predicted 1753
3 SASI_Mm01_00119240 predicted 2218
4 SASI_Mm01_00119241 predicted 553
5 SASI_Mm01_00119242 predicted 435
6 SASI_Mm02_00341421 predicted 484
7 SASI_Mm02_00341422 predicted 1472
8 SASI_Mm01_00119243 predicted 987
9 SASI_Mm01_00119244 predicted 950
10 SASI_Mm01_00119245 predicted 664
11 SASI_Mm01_00119237 predicted 1200
12 SASI_Mm01_00119246 predicted 1499
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145955
VALIDATED
MCMBP MISSION shRNA Bacterial Glycerol Stock
minichromosome maintenance complex binding protein
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000176032    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145955.2-1045s1c1
Sequence:CCGGGCGTACTGAATAGTGAGGAAACTCGAGTTTCCTCACTATTCAGTACGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173557    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145955.2-1880s1c1
Sequence:CCGGGCTCAACAAGTTCCGGATCTACTCGAGTAGATCCGGAACTTGTTGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216975    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145955.3-1928s1c1
Sequence:CCGGCAACCTATCAGACGACATAACCTCGAGGTTATGTCGTCTGATAGGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000265144    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_145955.3-724s21c1
Sequence:CCGGGTAGGCACAAGAGGAGTTATGCTCGAGCATAACTCCTCTTGTGCCTACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000265145    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_145955.3-1927s21c1
Sequence:CCGGACAACCTATCAGACGACATAACTCGAGTTATGTCGTCTGATAGGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000265146    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145955.3-1491s21c1
Sequence:CCGGTTTCGTCTACAGATGACAATACTCGAGTATTGTCATCTGTAGACGAAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000265143    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145955.3-3697s21c1
Sequence:CCGGACCAATGTAAACCGTAATTTACTCGAGTAAATTACGGTTTACATTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000265142    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_145955.3-760s21c1
Sequence:CCGGTGGACCTACAGCCCAGTAAACCTCGAGGTTTACTGGGCTGTAGGTCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145955
VALIDATED
MCMBP MISSION shRNA shRNA Plasmid DNA
minichromosome maintenance complex binding protein
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000176032    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145955.2-1045s1c1
Sequence:CCGGGCGTACTGAATAGTGAGGAAACTCGAGTTTCCTCACTATTCAGTACGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000173557    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145955.2-1880s1c1
Sequence:CCGGGCTCAACAAGTTCCGGATCTACTCGAGTAGATCCGGAACTTGTTGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000216975    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145955.3-1928s1c1
Sequence:CCGGCAACCTATCAGACGACATAACCTCGAGGTTATGTCGTCTGATAGGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000265144    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_145955.3-724s21c1
Sequence:CCGGGTAGGCACAAGAGGAGTTATGCTCGAGCATAACTCCTCTTGTGCCTACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000265145    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_145955.3-1927s21c1
Sequence:CCGGACAACCTATCAGACGACATAACTCGAGTTATGTCGTCTGATAGGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000265146    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145955.3-1491s21c1
Sequence:CCGGTTTCGTCTACAGATGACAATACTCGAGTATTGTCATCTGTAGACGAAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000265143    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145955.3-3697s21c1
Sequence:CCGGACCAATGTAAACCGTAATTTACTCGAGTAAATTACGGTTTACATTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000265142    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_145955.3-760s21c1
Sequence:CCGGTGGACCTACAGCCCAGTAAACCTCGAGGTTTACTGGGCTGTAGGTCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145955
VALIDATED
MCMBP MISSION shRNA Lentiviral Transduction Particles
minichromosome maintenance complex binding protein
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000176032    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145955.2-1045s1c1
Sequence:CCGGGCGTACTGAATAGTGAGGAAACTCGAGTTTCCTCACTATTCAGTACGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173557    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145955.2-1880s1c1
Sequence:CCGGGCTCAACAAGTTCCGGATCTACTCGAGTAGATCCGGAACTTGTTGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216975    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145955.3-1928s1c1
Sequence:CCGGCAACCTATCAGACGACATAACCTCGAGGTTATGTCGTCTGATAGGTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000265144    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_145955.3-724s21c1
Sequence:CCGGGTAGGCACAAGAGGAGTTATGCTCGAGCATAACTCCTCTTGTGCCTACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000265145    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_145955.3-1927s21c1
Sequence:CCGGACAACCTATCAGACGACATAACTCGAGTTATGTCGTCTGATAGGTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000265146    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145955.3-1491s21c1
Sequence:CCGGTTTCGTCTACAGATGACAATACTCGAGTATTGTCATCTGTAGACGAAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000265143    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145955.3-3697s21c1
Sequence:CCGGACCAATGTAAACCGTAATTTACTCGAGTAAATTACGGTTTACATTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000265142    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_145955.3-760s21c1
Sequence:CCGGTGGACCTACAGCCCAGTAAACCTCGAGGTTTACTGGGCTGTAGGTCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024834
VALIDATED
MCMBP MISSION shRNA Bacterial Glycerol Stock
minichromosome maintenance complex binding protein
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000172345    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024834.1-1521s1c1
Sequence:CCGGCCCAGCAATACTTCCCTTGTACTCGAGTACAAGGGAAGTATTGCTGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000281628    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_024834.2-1389s21c1
Sequence:CCGGTGGCTGCTGAATACCTTATATCTCGAGATATAAGGTATTCAGCAGCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263794    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024834.2-2909s21c1
Sequence:CCGGTTGCCAAGTAATCCGAATAAACTCGAGTTTATTCGGATTACTTGGCAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263793    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_024834.2-1242s21c1
Sequence:CCGGTGCAACACATCAACCCATTATCTCGAGATAATGGGTTGATGTGTTGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263792    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_024834.2-1508s21c1
Sequence:CCGGGAACACTTGTATCGAATTATTCTCGAGAATAATTCGATACAAGTGTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263791    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_024834.2-783s21c1
Sequence:CCGGGTCGCCACAAGAGGAGTTATGCTCGAGCATAACTCCTCTTGTGGCGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024834
VALIDATED
MCMBP MISSION shRNA shRNA Plasmid DNA
minichromosome maintenance complex binding protein
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000172345    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024834.1-1521s1c1
Sequence:CCGGCCCAGCAATACTTCCCTTGTACTCGAGTACAAGGGAAGTATTGCTGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000281628    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_024834.2-1389s21c1
Sequence:CCGGTGGCTGCTGAATACCTTATATCTCGAGATATAAGGTATTCAGCAGCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000263794    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024834.2-2909s21c1
Sequence:CCGGTTGCCAAGTAATCCGAATAAACTCGAGTTTATTCGGATTACTTGGCAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000263793    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_024834.2-1242s21c1
Sequence:CCGGTGCAACACATCAACCCATTATCTCGAGATAATGGGTTGATGTGTTGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000263792    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_024834.2-1508s21c1
Sequence:CCGGGAACACTTGTATCGAATTATTCTCGAGAATAATTCGATACAAGTGTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000263791    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_024834.2-783s21c1
Sequence:CCGGGTCGCCACAAGAGGAGTTATGCTCGAGCATAACTCCTCTTGTGGCGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024834
VALIDATED
MCMBP MISSION shRNA Lentiviral Transduction Particles
minichromosome maintenance complex binding protein
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000172345    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024834.1-1521s1c1
Sequence:CCGGCCCAGCAATACTTCCCTTGTACTCGAGTACAAGGGAAGTATTGCTGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000281628    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_024834.2-1389s21c1
Sequence:CCGGTGGCTGCTGAATACCTTATATCTCGAGATATAAGGTATTCAGCAGCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263794    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024834.2-2909s21c1
Sequence:CCGGTTGCCAAGTAATCCGAATAAACTCGAGTTTATTCGGATTACTTGGCAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263793    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_024834.2-1242s21c1
Sequence:CCGGTGCAACACATCAACCCATTATCTCGAGATAATGGGTTGATGTGTTGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263792    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_024834.2-1508s21c1
Sequence:CCGGGAACACTTGTATCGAATTATTCTCGAGAATAATTCGATACAAGTGTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263791    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_024834.2-783s21c1
Sequence:CCGGGTCGCCACAAGAGGAGTTATGCTCGAGCATAACTCCTCTTGTGGCGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)