EMAIL THIS PAGE TO A FRIEND

MCMDC2

minichromosome maintenance domain containing 2

60 Gene Product Result for
Synonyms: C8orf45
UniProtKB ID: Q4G0Z9, B4DYZ3, B4DZM4, B4E293, Q6P533, Q7Z3P4
Gene ID:
Mouse(240697) minichromosome maintenance domain containing 2
Rat(500392) minichromosome maintenance domain containing 2
domestic guinea pig(100717438) minichromosome maintenance domain containing 2
naked mole-rat(101711255) minichromosome maintenance domain containing 2
sheep(101122869) minichromosome maintenance domain containing 2
Zebrafish(323848) minichromosome maintenance domain containing 2
dog(486982) minichromosome maintenance domain containing 2
cow(528249) minichromosome maintenance domain containing 2
domestic cat(101091595) minichromosome maintenance domain containing 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_173518 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_173518 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_173518 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_177722 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_177722 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_177722 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_173518 Rosetta Predictions human pricing
NM_001024340 Rosetta Predictions rat pricing
NM_177722 Rosetta Predictions mouse pricing
XM_975177 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173518 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00368298 predicted 1102
2 SASI_Hs01_00021261 predicted 1484
3 SASI_Hs01_00021262 predicted 276
4 SASI_Hs01_00021263 predicted 483
5 SASI_Hs01_00021264 predicted 669
6 SASI_Hs01_00021265 predicted 246
7 SASI_Hs01_00021267 predicted 1504
8 SASI_Hs01_00021268 predicted 566
9 SASI_Hs01_00021269 predicted 439
10 SASI_Hs02_00368299 predicted 997
11 SASI_Hs01_00021260 predicted 1723
12 SASI_Hs01_00021266 predicted 370
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001024340 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00067480 predicted 2059
2 SASI_Rn01_00067481 predicted 941
3 SASI_Rn01_00067482 predicted 1475
4 SASI_Rn01_00067483 predicted 1712
5 SASI_Rn01_00067484 predicted 2162
6 SASI_Rn01_00067485 predicted 1863
7 SASI_Rn02_00202568 predicted 1568
8 SASI_Rn01_00067487 predicted 1884
9 SASI_Rn01_00067488 predicted 482
10 SASI_Rn01_00067489 predicted 706
11 SASI_Rn01_00067486 predicted 1219
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177722 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00348069 predicted 1727
2 SASI_Mm02_00348070 predicted 415
3 SASI_Mm02_00348071 predicted 2011
4 SASI_Mm02_00348072 predicted 1537
5 SASI_Mm02_00348073 predicted 2129
6 SASI_Mm02_00348074 predicted 775
7 SASI_Mm02_00348075 predicted 1622
8 SASI_Mm02_00348076 predicted 1480
9 SASI_Mm02_00348077 predicted 482
10 SASI_Mm02_00348078 predicted 331
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_975177 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00257336 predicted 955
2 SASI_Mm01_00257337 predicted 1483
3 SASI_Mm01_00257338 predicted 1645
4 SASI_Mm01_00257339 predicted 1834
5 SASI_Mm01_00257340 predicted 1921
6 SASI_Mm01_00257341 predicted 1446
7 SASI_Mm01_00257342 predicted 2038
8 SASI_Mm01_00257343 predicted 1931
9 SASI_Mm01_00257344 predicted 1533
10 SASI_Mm01_00257345 predicted 2052
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_173518
MCMDC2 MISSION shRNA Bacterial Glycerol Stock
minichromosome maintenance domain containing 2
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000435285    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173518.4-2372s21c1
Sequence:CCGGCTAATTGCTAATGGGATAAATCTCGAGATTTATCCCATTAGCAATTAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413261    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173518.4-1849s21c1
Sequence:CCGGAGAATGACCCATGGCTATTATCTCGAGATAATAGCCATGGGTCATTCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419296    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173518.4-1220s21c1
Sequence:CCGGCAAGTGATACTCTACTCATAGCTCGAGCTATGAGTAGAGTATCACTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150099    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173518.2-1019s1c1
Sequence:CCGGCTCTGTTTGTTGATGAGTCTACTCGAGTAGACTCATCAACAAACAGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149097    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173518.2-215s1c1
Sequence:CCGGGCTGAGCTTGGAAATCACATTCTCGAGAATGTGATTTCCAAGCTCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147266    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173518.2-319s1c1
Sequence:CCGGGCAGACTGAAACGCAAATTAACTCGAGTTAATTTGCGTTTCAGTCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149391    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173518.2-1272s1c1
Sequence:CCGGGCTTTATAGGAGACTTGGCTTCTCGAGAAGCCAAGTCTCCTATAAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149831    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_173518.2-1910s1c1
Sequence:CCGGCTGCTTGATTGCTAGTTGGTTCTCGAGAACCAACTAGCAATCAAGCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146420    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173518.2-371s1c1
Sequence:CCGGCTGCCAAGTTATGGTCTTGATCTCGAGATCAAGACCATAACTTGGCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_173518
MCMDC2 MISSION shRNA shRNA Plasmid DNA
minichromosome maintenance domain containing 2
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000435285    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173518.4-2372s21c1
Sequence:CCGGCTAATTGCTAATGGGATAAATCTCGAGATTTATCCCATTAGCAATTAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000413261    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173518.4-1849s21c1
Sequence:CCGGAGAATGACCCATGGCTATTATCTCGAGATAATAGCCATGGGTCATTCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000419296    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173518.4-1220s21c1
Sequence:CCGGCAAGTGATACTCTACTCATAGCTCGAGCTATGAGTAGAGTATCACTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000150099    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173518.2-1019s1c1
Sequence:CCGGCTCTGTTTGTTGATGAGTCTACTCGAGTAGACTCATCAACAAACAGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000149097    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173518.2-215s1c1
Sequence:CCGGGCTGAGCTTGGAAATCACATTCTCGAGAATGTGATTTCCAAGCTCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000147266    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173518.2-319s1c1
Sequence:CCGGGCAGACTGAAACGCAAATTAACTCGAGTTAATTTGCGTTTCAGTCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000149391    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173518.2-1272s1c1
Sequence:CCGGGCTTTATAGGAGACTTGGCTTCTCGAGAAGCCAAGTCTCCTATAAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000149831    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_173518.2-1910s1c1
Sequence:CCGGCTGCTTGATTGCTAGTTGGTTCTCGAGAACCAACTAGCAATCAAGCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000146420    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173518.2-371s1c1
Sequence:CCGGCTGCCAAGTTATGGTCTTGATCTCGAGATCAAGACCATAACTTGGCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_173518
MCMDC2 MISSION shRNA Lentiviral Transduction Particles
minichromosome maintenance domain containing 2
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000435285    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173518.4-2372s21c1
Sequence:CCGGCTAATTGCTAATGGGATAAATCTCGAGATTTATCCCATTAGCAATTAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413261    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173518.4-1849s21c1
Sequence:CCGGAGAATGACCCATGGCTATTATCTCGAGATAATAGCCATGGGTCATTCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419296    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173518.4-1220s21c1
Sequence:CCGGCAAGTGATACTCTACTCATAGCTCGAGCTATGAGTAGAGTATCACTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150099    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173518.2-1019s1c1
Sequence:CCGGCTCTGTTTGTTGATGAGTCTACTCGAGTAGACTCATCAACAAACAGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149097    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173518.2-215s1c1
Sequence:CCGGGCTGAGCTTGGAAATCACATTCTCGAGAATGTGATTTCCAAGCTCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147266    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173518.2-319s1c1
Sequence:CCGGGCAGACTGAAACGCAAATTAACTCGAGTTAATTTGCGTTTCAGTCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149391    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173518.2-1272s1c1
Sequence:CCGGGCTTTATAGGAGACTTGGCTTCTCGAGAAGCCAAGTCTCCTATAAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149831    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_173518.2-1910s1c1
Sequence:CCGGCTGCTTGATTGCTAGTTGGTTCTCGAGAACCAACTAGCAATCAAGCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146420    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173518.2-371s1c1
Sequence:CCGGCTGCCAAGTTATGGTCTTGATCTCGAGATCAAGACCATAACTTGGCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177722
MCMDC2 MISSION shRNA Bacterial Glycerol Stock
minichromosome maintenance domain containing 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000264915    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177722.3-214s21c1
Sequence:CCGGCTATCGGTTCAGTATTCTAATCTCGAGATTAGAATACTGAACCGATAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264914    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177722.3-1116s21c1
Sequence:CCGGGAGAAGACTGCTTGGATATTTCTCGAGAAATATCCAAGCAGTCTTCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264913    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177722.3-440s21c1
Sequence:CCGGCTTTGTGAGTTTCCACTTAATCTCGAGATTAAGTGGAAACTCACAAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264912    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177722.3-2187s21c1
Sequence:CCGGGATGTTCACAGTCAGCTATAGCTCGAGCTATAGCTGACTGTGAACATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000283222    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177722.3-1775s21c1
Sequence:CCGGAGAATGATTCATGGCTATTATCTCGAGATAATAGCCATGAATCATTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177722
MCMDC2 MISSION shRNA shRNA Plasmid DNA
minichromosome maintenance domain containing 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000264915    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177722.3-214s21c1
Sequence:CCGGCTATCGGTTCAGTATTCTAATCTCGAGATTAGAATACTGAACCGATAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000264914    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177722.3-1116s21c1
Sequence:CCGGGAGAAGACTGCTTGGATATTTCTCGAGAAATATCCAAGCAGTCTTCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000264913    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177722.3-440s21c1
Sequence:CCGGCTTTGTGAGTTTCCACTTAATCTCGAGATTAAGTGGAAACTCACAAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000264912    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177722.3-2187s21c1
Sequence:CCGGGATGTTCACAGTCAGCTATAGCTCGAGCTATAGCTGACTGTGAACATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000283222    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177722.3-1775s21c1
Sequence:CCGGAGAATGATTCATGGCTATTATCTCGAGATAATAGCCATGAATCATTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177722
MCMDC2 MISSION shRNA Lentiviral Transduction Particles
minichromosome maintenance domain containing 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000264915    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177722.3-214s21c1
Sequence:CCGGCTATCGGTTCAGTATTCTAATCTCGAGATTAGAATACTGAACCGATAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264914    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177722.3-1116s21c1
Sequence:CCGGGAGAAGACTGCTTGGATATTTCTCGAGAAATATCCAAGCAGTCTTCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264913    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177722.3-440s21c1
Sequence:CCGGCTTTGTGAGTTTCCACTTAATCTCGAGATTAAGTGGAAACTCACAAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264912    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177722.3-2187s21c1
Sequence:CCGGGATGTTCACAGTCAGCTATAGCTCGAGCTATAGCTGACTGTGAACATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000283222    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177722.3-1775s21c1
Sequence:CCGGAGAATGATTCATGGCTATTATCTCGAGATAATAGCCATGAATCATTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)