EMAIL THIS PAGE TO A FRIEND

MCOLN1

mucolipin 1

61 Gene Product Result for
Synonyms: MG-2 ML4 MLIV MST080 TRP-ML1 TRPM-L1 TRPML1
UniProtKB ID: Q9GZU1, D6W647, Q7Z4F7, Q9H292, Q9H4B3, Q9H4B5
Gene ID:
Human(57192) Summary: This gene encodes a memberof the transient receptor potential (TRP) cation channel gene family. The transmembrane protein localizes to intracellular vesicular membranes including lysosomes, and functions in the late endocytic pathway and in the regulation of lysosomal exocytosis. The channel is permeable to Ca(2+), Fe(2+), Na(+), K(+), and H(+), and is modulated by changes in Ca(2+) concentration. Mutations in this gene result in mucolipidosis type IV. [provided by RefSeq, Oct 2009]
Mouse(94178) mucolipin 1
Rat(288371) mucolipin 1
chicken(426164) mucolipin 1
dog(611517) mucolipin 1
cow(505738) mucolipin 1
Horse(100066441) mucolipin 1
sheep(101121931) mucolipin 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_053177 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_053177 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_053177 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_020533 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020533 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020533 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020533 Rosetta Predictions human pricing
NM_001105903 Rosetta Predictions rat pricing
NM_053177 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020533 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00067195 predicted 1252
2 SASI_Hs01_00067196 predicted 1414
3 SASI_Hs01_00067197 predicted 319
4 SASI_Hs01_00067198 predicted 1506
5 SASI_Hs01_00067199 predicted 1652
6 SASI_Hs01_00067201 predicted 1210
7 SASI_Hs01_00067202 predicted 1508
8 SASI_Hs01_00067203 predicted 1000
9 SASI_Hs01_00067204 predicted 1491
10 SASI_Hs02_00353581 predicted 1677
11 SASI_Hs01_00067200 predicted 1621
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001105903 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00213672 predicted 825
2 SASI_Rn02_00213673 predicted 336
3 SASI_Rn02_00213674 predicted 877
4 SASI_Rn02_00213675 predicted 1772
5 SASI_Rn02_00213676 predicted 891
6 SASI_Rn02_00213677 predicted 904
7 SASI_Rn02_00213678 predicted 1653
8 SASI_Rn02_00213679 predicted 1842
9 SASI_Rn02_00213680 predicted 769
10 SASI_Rn02_00213681 predicted 1320
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053177 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00109536 predicted 846
2 SASI_Mm01_00109537 predicted 282
3 SASI_Mm01_00109538 predicted 788
4 SASI_Mm01_00109539 predicted 1636
5 SASI_Mm01_00109541 predicted 741
6 SASI_Mm01_00109542 predicted 226
7 SASI_Mm01_00109543 predicted 1177
8 SASI_Mm01_00109544 predicted 1475
9 SASI_Mm01_00109545 predicted 1272
10 SASI_Mm02_00337735 predicted 1202
11 SASI_Mm01_00109540 predicted 836
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_053177
VALIDATED
MCOLN1 MISSION shRNA Bacterial Glycerol Stock
mucolipin 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000102835    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_053177.1-206s1c1
Sequence:CCGGGCCGCCTCAAGTACTTCTTTACTCGAGTAAAGAAGTACTTGAGGCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102836    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_053177.1-1207s1c1
Sequence:CCGGGCAAAGAACCTAGCCAGCTATCTCGAGATAGCTGGCTAGGTTCTTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102837    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_053177.1-483s1c1
Sequence:CCGGGTACCTGATACTACCTGAGATCTCGAGATCTCAGGTAGTATCAGGTACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102839    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_053177.1-485s1c1
Sequence:CCGGACCTGATACTACCTGAGATATCTCGAGATATCTCAGGTAGTATCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102838    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_053177.1-738s1c1
Sequence:CCGGCCTCACACTGAAATTCCACAACTCGAGTTGTGGAATTTCAGTGTGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000326377    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_053177.1-738s21c1
Sequence:CCGGCCTCACACTGAAATTCCACAACTCGAGTTGTGGAATTTCAGTGTGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000311492    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_053177.1-1827s21c1
Sequence:CCGGGATGATTGCCACTAGACTTTACTCGAGTAAAGTCTAGTGGCAATCATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000326378    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_053177.1-1207s21c1
Sequence:CCGGGCAAAGAACCTAGCCAGCTATCTCGAGATAGCTGGCTAGGTTCTTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000326375    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_053177.1-483s21c1
Sequence:CCGGGTACCTGATACTACCTGAGATCTCGAGATCTCAGGTAGTATCAGGTACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000326379    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053177.1-206s21c1
Sequence:CCGGGCCGCCTCAAGTACTTCTTTACTCGAGTAAAGAAGTACTTGAGGCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_053177
VALIDATED
MCOLN1 MISSION shRNA shRNA Plasmid DNA
mucolipin 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000102835    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_053177.1-206s1c1
Sequence:CCGGGCCGCCTCAAGTACTTCTTTACTCGAGTAAAGAAGTACTTGAGGCGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000102836    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_053177.1-1207s1c1
Sequence:CCGGGCAAAGAACCTAGCCAGCTATCTCGAGATAGCTGGCTAGGTTCTTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000102837    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_053177.1-483s1c1
Sequence:CCGGGTACCTGATACTACCTGAGATCTCGAGATCTCAGGTAGTATCAGGTACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000102839    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_053177.1-485s1c1
Sequence:CCGGACCTGATACTACCTGAGATATCTCGAGATATCTCAGGTAGTATCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000102838    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_053177.1-738s1c1
Sequence:CCGGCCTCACACTGAAATTCCACAACTCGAGTTGTGGAATTTCAGTGTGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000326377    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_053177.1-738s21c1
Sequence:CCGGCCTCACACTGAAATTCCACAACTCGAGTTGTGGAATTTCAGTGTGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000311492    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_053177.1-1827s21c1
Sequence:CCGGGATGATTGCCACTAGACTTTACTCGAGTAAAGTCTAGTGGCAATCATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000326378    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_053177.1-1207s21c1
Sequence:CCGGGCAAAGAACCTAGCCAGCTATCTCGAGATAGCTGGCTAGGTTCTTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000326375    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_053177.1-483s21c1
Sequence:CCGGGTACCTGATACTACCTGAGATCTCGAGATCTCAGGTAGTATCAGGTACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000326379    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053177.1-206s21c1
Sequence:CCGGGCCGCCTCAAGTACTTCTTTACTCGAGTAAAGAAGTACTTGAGGCGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_053177
VALIDATED
MCOLN1 MISSION shRNA Lentiviral Transduction Particles
mucolipin 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000102835    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_053177.1-206s1c1
Sequence:CCGGGCCGCCTCAAGTACTTCTTTACTCGAGTAAAGAAGTACTTGAGGCGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102836    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_053177.1-1207s1c1
Sequence:CCGGGCAAAGAACCTAGCCAGCTATCTCGAGATAGCTGGCTAGGTTCTTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102837    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_053177.1-483s1c1
Sequence:CCGGGTACCTGATACTACCTGAGATCTCGAGATCTCAGGTAGTATCAGGTACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102839    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_053177.1-485s1c1
Sequence:CCGGACCTGATACTACCTGAGATATCTCGAGATATCTCAGGTAGTATCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102838    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_053177.1-738s1c1
Sequence:CCGGCCTCACACTGAAATTCCACAACTCGAGTTGTGGAATTTCAGTGTGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000326377    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_053177.1-738s21c1
Sequence:CCGGCCTCACACTGAAATTCCACAACTCGAGTTGTGGAATTTCAGTGTGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000311492    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_053177.1-1827s21c1
Sequence:CCGGGATGATTGCCACTAGACTTTACTCGAGTAAAGTCTAGTGGCAATCATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000326378    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_053177.1-1207s21c1
Sequence:CCGGGCAAAGAACCTAGCCAGCTATCTCGAGATAGCTGGCTAGGTTCTTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000326375    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_053177.1-483s21c1
Sequence:CCGGGTACCTGATACTACCTGAGATCTCGAGATCTCAGGTAGTATCAGGTACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000326379    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053177.1-206s21c1
Sequence:CCGGGCCGCCTCAAGTACTTCTTTACTCGAGTAAAGAAGTACTTGAGGCGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020533
MCOLN1 MISSION shRNA Bacterial Glycerol Stock
mucolipin 1
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000083294    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020533.1-249s1c1
Sequence:CCGGCGCCGTCGTCTCAAATACTTTCTCGAGAAAGTATTTGAGACGACGGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083293    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020533.1-1349s1c1
Sequence:CCGGCCACAACTACAATATCCTCATCTCGAGATGAGGATATTGTAGTTGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083297    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020533.1-896s1c1
Sequence:CCGGCGTCCTGATCACGTTTGACAACTCGAGTTGTCAAACGTGATCAGGACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083296    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020533.1-899s1c1
Sequence:CCGGCCTGATCACGTTTGACAACAACTCGAGTTGTTGTCAAACGTGATCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000444187    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020533.2-1529s21c1
Sequence:CCGGGCCTGTTCTCGCTCATCAATGCTCGAGCATTGATGAGCGAGAACAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419191    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020533.2-1867s21c1
Sequence:CCGGTCGCTGCTGGTGAATTGATTCCTCGAGGAATCAATTCACCAGCAGCGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020533
MCOLN1 MISSION shRNA shRNA Plasmid DNA
mucolipin 1
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000083294    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020533.1-249s1c1
Sequence:CCGGCGCCGTCGTCTCAAATACTTTCTCGAGAAAGTATTTGAGACGACGGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000083293    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020533.1-1349s1c1
Sequence:CCGGCCACAACTACAATATCCTCATCTCGAGATGAGGATATTGTAGTTGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000083297    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020533.1-896s1c1
Sequence:CCGGCGTCCTGATCACGTTTGACAACTCGAGTTGTCAAACGTGATCAGGACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000083296    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020533.1-899s1c1
Sequence:CCGGCCTGATCACGTTTGACAACAACTCGAGTTGTTGTCAAACGTGATCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000444187    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020533.2-1529s21c1
Sequence:CCGGGCCTGTTCTCGCTCATCAATGCTCGAGCATTGATGAGCGAGAACAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000419191    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020533.2-1867s21c1
Sequence:CCGGTCGCTGCTGGTGAATTGATTCCTCGAGGAATCAATTCACCAGCAGCGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020533
MCOLN1 MISSION shRNA Lentiviral Transduction Particles
mucolipin 1
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000083294    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020533.1-249s1c1
Sequence:CCGGCGCCGTCGTCTCAAATACTTTCTCGAGAAAGTATTTGAGACGACGGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083293    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020533.1-1349s1c1
Sequence:CCGGCCACAACTACAATATCCTCATCTCGAGATGAGGATATTGTAGTTGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083297    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020533.1-896s1c1
Sequence:CCGGCGTCCTGATCACGTTTGACAACTCGAGTTGTCAAACGTGATCAGGACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083296    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020533.1-899s1c1
Sequence:CCGGCCTGATCACGTTTGACAACAACTCGAGTTGTTGTCAAACGTGATCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000444187    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020533.2-1529s21c1
Sequence:CCGGGCCTGTTCTCGCTCATCAATGCTCGAGCATTGATGAGCGAGAACAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419191    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020533.2-1867s21c1
Sequence:CCGGTCGCTGCTGGTGAATTGATTCCTCGAGGAATCAATTCACCAGCAGCGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)