EMAIL THIS PAGE TO A FRIEND

MCOLN2

mucolipin 2

63 Gene Product Result for
Synonyms: TRP-ML2 TRPML2
UniProtKB ID: Q8IZK6, A6NI99, Q2M3I6, Q5TAG5, Q8N9R3
Gene ID:
Human(255231) Summary: Mucolipins constitute a family of cation channel proteins with homology to the transient receptor potential superfamily. In mammals, the mucolipin family includes 3 members, MCOLN1 (MIM 605248), MCOLN2, and MCOLN3 (MIM 607400), that exhibit a common 6-membrane-spanning topology. Homologs of mammalian mucolipins exist in Drosophila and C. elegans. Mutations in the human MCOLN1 gene cause mucolipodosis IV (MIM 262650) (Karacsonyi et al., 2007 [PubMed 17662026]
Mouse(68279) mucolipin 2
Rat(292168) mucolipin 2
Zebrafish(394123) mucolipin 2
dog(490186) mucolipin 2
Horse(100052719) mucolipin 2
cow(532671) mucolipin 2
chicken(424531) mucolipin 2
sheep(101111406) mucolipin 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001005846 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001005846 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001005846 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_153259 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_153259 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_153259 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU121971 MISSION® esiRNA esiRNA human MCOLN2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_153259 Rosetta Predictions human pricing
NM_001039005 Rosetta Predictions rat pricing
NM_001005846 Rosetta Predictions mouse pricing
NM_026656 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153259 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00148154 predicted 756
2 SASI_Hs01_00148155 predicted 1917
3 SASI_Hs02_00367126 predicted 917
4 SASI_Hs01_00148156 predicted 1807
5 SASI_Hs01_00148157 predicted 1269
6 SASI_Hs01_00148158 predicted 1306
7 SASI_Hs02_00367127 predicted 428
8 SASI_Hs01_00148159 predicted 1440
9 SASI_Hs01_00148160 predicted 1257
10 SASI_Hs02_00367128 predicted 1932
11 SASI_Hs01_00148152 predicted 380
12 SASI_Hs01_00148153 predicted 1522
13 SASI_Hs01_00148161 predicted 1532
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039005 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00050356 predicted 1094
2 SASI_Rn01_00050357 predicted 1493
3 SASI_Rn01_00050358 predicted 393
4 SASI_Rn01_00050359 predicted 663
5 SASI_Rn01_00050360 predicted 1775
6 SASI_Rn01_00050361 predicted 953
7 SASI_Rn01_00050362 predicted 701
8 SASI_Rn01_00050363 predicted 975
9 SASI_Rn02_00204727 predicted 1594
10 SASI_Rn01_00050364 predicted 1240
11 SASI_Rn01_00050365 predicted 968
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001005846 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00071655 predicted 1114
2 SASI_Mm01_00071656 predicted 1243
3 SASI_Mm01_00071657 predicted 1591
4 SASI_Mm01_00071658 predicted 412
5 SASI_Mm01_00071660 predicted 1529
6 SASI_Mm01_00071662 predicted 866
7 SASI_Mm02_00286656 predicted 1745
8 SASI_Mm01_00071663 predicted 615
9 SASI_Mm01_00071664 predicted 1802
10 SASI_Mm02_00286657 predicted 1858
11 SASI_Mm01_00071659 predicted 1755
12 SASI_Mm01_00071661 predicted 781
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026656 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00093131 predicted 1137
2 SASI_Mm01_00093132 predicted 1273
3 SASI_Mm01_00093133 predicted 1623
4 SASI_Mm01_00093134 predicted 443
5 SASI_Mm01_00093136 predicted 1557
6 SASI_Mm01_00093138 predicted 896
7 SASI_Mm02_00330646 predicted 1777
8 SASI_Mm01_00093139 predicted 651
9 SASI_Mm01_00093140 predicted 1821
10 SASI_Mm02_00330647 predicted 1894
11 SASI_Mm01_00093135 predicted 1780
12 SASI_Mm01_00093137 predicted 813
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001005846
VALIDATED
MCOLN2 MISSION shRNA Bacterial Glycerol Stock
mucolipin 2
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000376895    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001005846.2-1752s21c1
Sequence:CCGGACTTGATTCTCATTGACTAAACTCGAGTTTAGTCAATGAGAATCAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000376896    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001005846.2-1592s21c1
Sequence:CCGGGACTCTTACCACACCATTAAGCTCGAGCTTAATGGTGTGGTAAGAGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366580    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001005846.2-2009s21c1
Sequence:CCGGGGTCGTTTGTGACATCATAATCTCGAGATTATGATGTCACAAACGACCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366514    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001005846.2-416s21c1
Sequence:CCGGGACTACAGCTGTAGCATATACCTCGAGGTATATGCTACAGCTGTAGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366579    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001005846.2-1272s21c1
Sequence:CCGGAGACGTACAACGTGCTCATTTCTCGAGAAATGAGCACGTTGTACGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102989    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005846.1-771s1c1
Sequence:CCGGGCCAACATCGAAGAGTGTAAACTCGAGTTTACACTCTTCGATGTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102986    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_001005846.1-170s1c1
Sequence:CCGGGCAGATATTGAAGATAGTCATCTCGAGATGACTATCTTCAATATCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102987    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005846.1-1416s1c1
Sequence:CCGGCGCCTCTACCTGTATTCCTTTCTCGAGAAAGGAATACAGGTAGAGGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102988    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_001005846.1-917s1c1
Sequence:CCGGGCTGAGGAAGAGATTTCTAAACTCGAGTTTAGAAATCTCTTCCTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102985    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001005846.1-2095s1c1
Sequence:CCGGCCAAATTAAGACTTGAAGCTACTCGAGTAGCTTCAAGTCTTAATTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000376894    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001005846.2-946s21c1
Sequence:CCGGGTTTGATGTGTTCGTCATTATCTCGAGATAATGACGAACACATCAAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001005846
VALIDATED
MCOLN2 MISSION shRNA shRNA Plasmid DNA
mucolipin 2
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000376895    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001005846.2-1752s21c1
Sequence:CCGGACTTGATTCTCATTGACTAAACTCGAGTTTAGTCAATGAGAATCAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000376896    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001005846.2-1592s21c1
Sequence:CCGGGACTCTTACCACACCATTAAGCTCGAGCTTAATGGTGTGGTAAGAGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000366580    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001005846.2-2009s21c1
Sequence:CCGGGGTCGTTTGTGACATCATAATCTCGAGATTATGATGTCACAAACGACCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000366514    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001005846.2-416s21c1
Sequence:CCGGGACTACAGCTGTAGCATATACCTCGAGGTATATGCTACAGCTGTAGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000366579    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001005846.2-1272s21c1
Sequence:CCGGAGACGTACAACGTGCTCATTTCTCGAGAAATGAGCACGTTGTACGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000102989    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005846.1-771s1c1
Sequence:CCGGGCCAACATCGAAGAGTGTAAACTCGAGTTTACACTCTTCGATGTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000102986    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_001005846.1-170s1c1
Sequence:CCGGGCAGATATTGAAGATAGTCATCTCGAGATGACTATCTTCAATATCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000102987    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005846.1-1416s1c1
Sequence:CCGGCGCCTCTACCTGTATTCCTTTCTCGAGAAAGGAATACAGGTAGAGGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000102988    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_001005846.1-917s1c1
Sequence:CCGGGCTGAGGAAGAGATTTCTAAACTCGAGTTTAGAAATCTCTTCCTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000102985    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001005846.1-2095s1c1
Sequence:CCGGCCAAATTAAGACTTGAAGCTACTCGAGTAGCTTCAAGTCTTAATTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000376894    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001005846.2-946s21c1
Sequence:CCGGGTTTGATGTGTTCGTCATTATCTCGAGATAATGACGAACACATCAAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001005846
VALIDATED
MCOLN2 MISSION shRNA Lentiviral Transduction Particles
mucolipin 2
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000376895    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001005846.2-1752s21c1
Sequence:CCGGACTTGATTCTCATTGACTAAACTCGAGTTTAGTCAATGAGAATCAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000376896    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001005846.2-1592s21c1
Sequence:CCGGGACTCTTACCACACCATTAAGCTCGAGCTTAATGGTGTGGTAAGAGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366580    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001005846.2-2009s21c1
Sequence:CCGGGGTCGTTTGTGACATCATAATCTCGAGATTATGATGTCACAAACGACCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366514    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001005846.2-416s21c1
Sequence:CCGGGACTACAGCTGTAGCATATACCTCGAGGTATATGCTACAGCTGTAGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366579    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001005846.2-1272s21c1
Sequence:CCGGAGACGTACAACGTGCTCATTTCTCGAGAAATGAGCACGTTGTACGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102989    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005846.1-771s1c1
Sequence:CCGGGCCAACATCGAAGAGTGTAAACTCGAGTTTACACTCTTCGATGTTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102986    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_001005846.1-170s1c1
Sequence:CCGGGCAGATATTGAAGATAGTCATCTCGAGATGACTATCTTCAATATCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102987    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005846.1-1416s1c1
Sequence:CCGGCGCCTCTACCTGTATTCCTTTCTCGAGAAAGGAATACAGGTAGAGGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102988    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_001005846.1-917s1c1
Sequence:CCGGGCTGAGGAAGAGATTTCTAAACTCGAGTTTAGAAATCTCTTCCTCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102985    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001005846.1-2095s1c1
Sequence:CCGGCCAAATTAAGACTTGAAGCTACTCGAGTAGCTTCAAGTCTTAATTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000376894    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001005846.2-946s21c1
Sequence:CCGGGTTTGATGTGTTCGTCATTATCTCGAGATAATGACGAACACATCAAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153259
MCOLN2 MISSION shRNA Bacterial Glycerol Stock
mucolipin 2
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000150273    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153259.2-958s1c1
Sequence:CCGGGTTACCAGACTGTTATGTCTTCTCGAGAAGACATAACAGTCTGGTAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149168    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153259.2-2835s1c1
Sequence:CCGGGCATAGCCAGTGGGATAAATACTCGAGTATTTATCCCACTGGCTATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150177    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153259.2-2813s1c1
Sequence:CCGGGCATGATATGAAGCAACTGTTCTCGAGAACAGTTGCTTCATATCATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149877    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153259.2-1681s1c1
Sequence:CCGGGCTGTTCAGTCGTCTGTATTTCTCGAGAAATACAGACGACTGAACAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148829    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153259.2-1806s1c1
Sequence:CCGGCTGAAACGGATTTGCAGGAATCTCGAGATTCCTGCAAATCCGTTTCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000443068    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153259.2-2399s21c1
Sequence:CCGGAGTCCAAGCTGGCGAACTATTCTCGAGAATAGTTCGCCAGCTTGGACTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000440131    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153259.2-1763s21c1
Sequence:CCGGGATTCTTATGACACCATTAAGCTCGAGCTTAATGGTGTCATAAGAATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153259
MCOLN2 MISSION shRNA shRNA Plasmid DNA
mucolipin 2
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000150273    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153259.2-958s1c1
Sequence:CCGGGTTACCAGACTGTTATGTCTTCTCGAGAAGACATAACAGTCTGGTAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000149168    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153259.2-2835s1c1
Sequence:CCGGGCATAGCCAGTGGGATAAATACTCGAGTATTTATCCCACTGGCTATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000150177    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153259.2-2813s1c1
Sequence:CCGGGCATGATATGAAGCAACTGTTCTCGAGAACAGTTGCTTCATATCATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000149877    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153259.2-1681s1c1
Sequence:CCGGGCTGTTCAGTCGTCTGTATTTCTCGAGAAATACAGACGACTGAACAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000148829    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153259.2-1806s1c1
Sequence:CCGGCTGAAACGGATTTGCAGGAATCTCGAGATTCCTGCAAATCCGTTTCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000443068    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153259.2-2399s21c1
Sequence:CCGGAGTCCAAGCTGGCGAACTATTCTCGAGAATAGTTCGCCAGCTTGGACTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000440131    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153259.2-1763s21c1
Sequence:CCGGGATTCTTATGACACCATTAAGCTCGAGCTTAATGGTGTCATAAGAATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153259
MCOLN2 MISSION shRNA Lentiviral Transduction Particles
mucolipin 2
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000150273    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153259.2-958s1c1
Sequence:CCGGGTTACCAGACTGTTATGTCTTCTCGAGAAGACATAACAGTCTGGTAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149168    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153259.2-2835s1c1
Sequence:CCGGGCATAGCCAGTGGGATAAATACTCGAGTATTTATCCCACTGGCTATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150177    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153259.2-2813s1c1
Sequence:CCGGGCATGATATGAAGCAACTGTTCTCGAGAACAGTTGCTTCATATCATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149877    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153259.2-1681s1c1
Sequence:CCGGGCTGTTCAGTCGTCTGTATTTCTCGAGAAATACAGACGACTGAACAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148829    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153259.2-1806s1c1
Sequence:CCGGCTGAAACGGATTTGCAGGAATCTCGAGATTCCTGCAAATCCGTTTCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000443068    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153259.2-2399s21c1
Sequence:CCGGAGTCCAAGCTGGCGAACTATTCTCGAGAATAGTTCGCCAGCTTGGACTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000440131    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153259.2-1763s21c1
Sequence:CCGGGATTCTTATGACACCATTAAGCTCGAGCTTAATGGTGTCATAAGAATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)