EMAIL THIS PAGE TO A FRIEND

MCOLN3

mucolipin 3

100 Gene Product Result for
Synonyms: TRP-ML3 TRPML3
UniProtKB ID: Q8TDD5, Q5T4H5, Q5T4H6, Q9NV09
Gene ID:
Human(55283) Summary: This gene encodes one of members of the mucolipin cation channel proteins. Mutation studies of the highly similar protein in mice have shown that the protein is found in cochlea hair cells, and mutant mice show early-onset hearing loss and balance problems. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2011]
Mouse(171166) mucolipin 3
Rat(308022) mucolipin 3
sheep(101111919) mucolipin 3
chicken(429091) mucolipin 3
dog(490185) mucolipin 3
Horse(100064441) mucolipin 3
cow(514345) mucolipin 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018298 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018298 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018298 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_134160 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_134160 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_134160 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018298 Rosetta Predictions human pricing
NM_001012059 Rosetta Predictions rat pricing
XM_001079388 Rosetta Predictions rat pricing
XM_575058 Rosetta Predictions rat pricing
NM_134160 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018298 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00155820 predicted 616
2 SASI_Hs01_00155821 predicted 1816
3 SASI_Hs01_00155822 predicted 1680
4 SASI_Hs01_00155823 predicted 1196
5 SASI_Hs01_00155824 predicted 1587
6 SASI_Hs01_00155825 predicted 1748
7 SASI_Hs01_00155826 predicted 439
8 SASI_Hs02_00351701 predicted 841
9 SASI_Hs01_00155827 predicted 1171
10 SASI_Hs01_00155829 predicted 1010
11 SASI_Hs01_00155828 predicted 1631
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012059 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00091091 predicted 363
2 SASI_Rn01_00091092 predicted 1256
3 SASI_Rn01_00091093 predicted 539
4 SASI_Rn01_00091094 predicted 517
5 SASI_Rn01_00091095 predicted 1716
6 SASI_Rn01_00091096 predicted 861
7 SASI_Rn01_00091097 predicted 671
8 SASI_Rn01_00091098 predicted 1241
9 SASI_Rn01_00091099 predicted 1139
10 SASI_Rn01_00091100 predicted 1167
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001079388 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00364224 predicted 1323
2 SASI_Rn02_00364225 predicted 1349
3 SASI_Rn02_00364226 predicted 383
4 SASI_Rn02_00364227 predicted 554
5 SASI_Rn02_00364228 predicted 532
6 SASI_Rn02_00364229 predicted 876
7 SASI_Rn02_00364230 predicted 687
8 SASI_Rn02_00364231 predicted 1076
9 SASI_Rn02_00364232 predicted 1027
10 SASI_Rn02_00364233 predicted 396
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_575058 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00171106 predicted 2329
2 SASI_Rn01_00171107 predicted 2218
3 SASI_Rn01_00171108 predicted 2354
4 SASI_Rn01_00171109 predicted 2287
5 SASI_Rn01_00171110 predicted 2129
6 SASI_Rn01_00171111 predicted 2142
7 SASI_Rn01_00171112 predicted 2069
8 SASI_Rn01_00171113 predicted 404
9 SASI_Rn01_00171114 predicted 2287
10 SASI_Rn01_00171115 predicted 2106
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_134160 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00339425 predicted 1014
2 SASI_Mm01_00190795 predicted 365
3 SASI_Mm01_00190796 predicted 715
4 SASI_Mm01_00190797 predicted 522
5 SASI_Mm01_00190798 predicted 987
6 SASI_Mm01_00190799 predicted 542
7 SASI_Mm01_00190800 predicted 671
8 SASI_Mm01_00190801 predicted 1047
9 SASI_Mm01_00190802 predicted 1185
10 SASI_Mm01_00190803 predicted 462
11 SASI_Mm01_00190804 predicted 1263
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018298
MCOLN3 MISSION shRNA Bacterial Glycerol Stock
mucolipin 3
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000430431    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018298.9-2180s21c1
Sequence:CCGGGAGTGGGTGTAGTTATCATTTCTCGAGAAATGATAACTACACCCACTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428091    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018298.9-1714s21c1
Sequence:CCGGGATGACCCTCCAGTATCTTTACTCGAGTAAAGATACTGGAGGGTCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074308    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018298.9-2285s1c1
Sequence:CCGGGCACCAGCTAACAATGTGATACTCGAGTATCACATTGTTAGCTGGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074311    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018298.9-271s1c1
Sequence:CCGGCCATGGAAACTTGCCATACAACTCGAGTTGTATGGCAAGTTTCCATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074312    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018298.9-465s1c1
Sequence:CCGGTCAGTTAATCTTCGCAGTAAACTCGAGTTTACTGCGAAGATTAACTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074310    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018298.9-933s1c1
Sequence:CCGGGAACACTCATTACATGATGATCTCGAGATCATCATGTAATGAGTGTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074309    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018298.9-906s1c1
Sequence:CCGGCTGGCATGTATCTGGATCAATCTCGAGATTGATCCAGATACATGCCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420375    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018298.9-313s21c1
Sequence:CCGGACTATCCAGCTGGTCTTATTTCTCGAGAAATAAGACCAGCTGGATAGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416641    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018298.9-1144s21c1
Sequence:CCGGTTGACAATCATTGGATCAATTCTCGAGAATTGATCCAATGATTGTCAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018298
MCOLN3 MISSION shRNA shRNA Plasmid DNA
mucolipin 3
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000430431    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018298.9-2180s21c1
Sequence:CCGGGAGTGGGTGTAGTTATCATTTCTCGAGAAATGATAACTACACCCACTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000428091    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018298.9-1714s21c1
Sequence:CCGGGATGACCCTCCAGTATCTTTACTCGAGTAAAGATACTGGAGGGTCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074308    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018298.9-2285s1c1
Sequence:CCGGGCACCAGCTAACAATGTGATACTCGAGTATCACATTGTTAGCTGGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074311    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018298.9-271s1c1
Sequence:CCGGCCATGGAAACTTGCCATACAACTCGAGTTGTATGGCAAGTTTCCATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074312    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018298.9-465s1c1
Sequence:CCGGTCAGTTAATCTTCGCAGTAAACTCGAGTTTACTGCGAAGATTAACTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074310    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018298.9-933s1c1
Sequence:CCGGGAACACTCATTACATGATGATCTCGAGATCATCATGTAATGAGTGTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074309    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018298.9-906s1c1
Sequence:CCGGCTGGCATGTATCTGGATCAATCTCGAGATTGATCCAGATACATGCCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000420375    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018298.9-313s21c1
Sequence:CCGGACTATCCAGCTGGTCTTATTTCTCGAGAAATAAGACCAGCTGGATAGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000416641    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018298.9-1144s21c1
Sequence:CCGGTTGACAATCATTGGATCAATTCTCGAGAATTGATCCAATGATTGTCAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018298
MCOLN3 MISSION shRNA Lentiviral Transduction Particles
mucolipin 3
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000430431    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018298.9-2180s21c1
Sequence:CCGGGAGTGGGTGTAGTTATCATTTCTCGAGAAATGATAACTACACCCACTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428091    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018298.9-1714s21c1
Sequence:CCGGGATGACCCTCCAGTATCTTTACTCGAGTAAAGATACTGGAGGGTCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074308    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018298.9-2285s1c1
Sequence:CCGGGCACCAGCTAACAATGTGATACTCGAGTATCACATTGTTAGCTGGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074311    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018298.9-271s1c1
Sequence:CCGGCCATGGAAACTTGCCATACAACTCGAGTTGTATGGCAAGTTTCCATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074312    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018298.9-465s1c1
Sequence:CCGGTCAGTTAATCTTCGCAGTAAACTCGAGTTTACTGCGAAGATTAACTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074310    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018298.9-933s1c1
Sequence:CCGGGAACACTCATTACATGATGATCTCGAGATCATCATGTAATGAGTGTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074309    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018298.9-906s1c1
Sequence:CCGGCTGGCATGTATCTGGATCAATCTCGAGATTGATCCAGATACATGCCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420375    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018298.9-313s21c1
Sequence:CCGGACTATCCAGCTGGTCTTATTTCTCGAGAAATAAGACCAGCTGGATAGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416641    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018298.9-1144s21c1
Sequence:CCGGTTGACAATCATTGGATCAATTCTCGAGAATTGATCCAATGATTGTCAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_134160
MCOLN3 MISSION shRNA Bacterial Glycerol Stock
mucolipin 3
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000102905    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134160.1-1188s1c1
Sequence:CCGGGCGAAGTACAATCTCCTTATTCTCGAGAATAAGGAGATTGTACTTCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102906    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134160.1-728s1c1
Sequence:CCGGGCTGACTATAACATTCGACAACTCGAGTTGTCGAATGTTATAGTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102908    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134160.1-731s1c1
Sequence:CCGGGACTATAACATTCGACAACAACTCGAGTTGTTGTCGAATGTTATAGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102909    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134160.1-1260s1c1
Sequence:CCGGGCTATGATCTATCTAGGCTATCTCGAGATAGCCTAGATAGATCATAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102907    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134160.1-1360s1c1
Sequence:CCGGCGCTGATAAACGGAGACGATACTCGAGTATCGTCTCCGTTTATCAGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_134160
MCOLN3 MISSION shRNA shRNA Plasmid DNA
mucolipin 3
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000102905    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134160.1-1188s1c1
Sequence:CCGGGCGAAGTACAATCTCCTTATTCTCGAGAATAAGGAGATTGTACTTCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000102906    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134160.1-728s1c1
Sequence:CCGGGCTGACTATAACATTCGACAACTCGAGTTGTCGAATGTTATAGTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000102908    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134160.1-731s1c1
Sequence:CCGGGACTATAACATTCGACAACAACTCGAGTTGTTGTCGAATGTTATAGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000102909    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134160.1-1260s1c1
Sequence:CCGGGCTATGATCTATCTAGGCTATCTCGAGATAGCCTAGATAGATCATAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000102907    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134160.1-1360s1c1
Sequence:CCGGCGCTGATAAACGGAGACGATACTCGAGTATCGTCTCCGTTTATCAGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_134160
MCOLN3 MISSION shRNA Lentiviral Transduction Particles
mucolipin 3
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000102905    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134160.1-1188s1c1
Sequence:CCGGGCGAAGTACAATCTCCTTATTCTCGAGAATAAGGAGATTGTACTTCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102906    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134160.1-728s1c1
Sequence:CCGGGCTGACTATAACATTCGACAACTCGAGTTGTCGAATGTTATAGTCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102908    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134160.1-731s1c1
Sequence:CCGGGACTATAACATTCGACAACAACTCGAGTTGTTGTCGAATGTTATAGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102909    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134160.1-1260s1c1
Sequence:CCGGGCTATGATCTATCTAGGCTATCTCGAGATAGCCTAGATAGATCATAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102907    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134160.1-1360s1c1
Sequence:CCGGCGCTGATAAACGGAGACGATACTCGAGTATCGTCTCCGTTTATCAGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)