EMAIL THIS PAGE TO A FRIEND

MCPH1

microcephalin 1

56 Gene Product Result for
Synonyms: BRIT1 MCT
UniProtKB ID: Q8NEM0, B4DWW2, E9PGU5, E9PH63, Q66GU1, Q9H9C7
Gene ID:
Human(79648) Summary: This gene encodes a DNA damage response protein. The encoded protein may play a role in G2/M checkpoint arrest via maintenance of inhibitory phosphorylation of cyclin-dependent kinase 1. Mutations in this gene have been associated with primary autosomal recessive microcephaly 1 and premature chromosome condensation syndrome. Alternatively spliced transcript variants have been described. [provided by RefSeq, Feb 2010]
Mouse(244329) microcephaly, primary autosomal recessive 1
Rat(306594) microcephalin 1
naked mole-rat(101711665) microcephalin 1
sheep(100505404) microcephalin 1
Zebrafish(678616) microcephalin 1
fruit fly(36272) Microcephalin
cow(100125236) microcephalin 1
domestic cat(493941) microcephalin 1
dog(442960) microcephalin 1
chicken(100125976) microcephalin 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024596 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024596 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024596 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_173189 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_173189 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_173189 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024596 Rosetta Predictions human pricing
XM_001074501 Rosetta Predictions rat pricing
XM_225006 Rosetta Predictions rat pricing
NM_173189 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024596 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00016974 predicted 1474
2 SASI_Hs01_00016975 predicted 699
3 SASI_Hs01_00016976 predicted 1995
4 SASI_Hs01_00016977 predicted 658
5 SASI_Hs01_00016979 predicted 1545
6 SASI_Hs01_00016983 predicted 2481
7 SASI_Hs01_00016980 predicted 1475
8 SASI_Hs01_00016981 predicted 1795
9 SASI_Hs01_00016982 predicted 1344
10 SASI_Hs02_00356937 predicted 647
11 SASI_Hs01_00016978 predicted 2151
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001074501 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00346488 predicted 853
2 SASI_Rn02_00346489 predicted 669
3 SASI_Rn02_00346490 predicted 1529
4 SASI_Rn02_00346491 predicted 1405
5 SASI_Rn02_00346492 predicted 811
6 SASI_Rn02_00346493 predicted 1249
7 SASI_Rn02_00346494 predicted 1165
8 SASI_Rn02_00346495 predicted 1609
9 SASI_Rn02_00346496 predicted 1704
10 SASI_Rn02_00346497 predicted 1891
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_225006 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00382427 predicted 667
2 SASI_Rn02_00382428 predicted 322
3 SASI_Rn02_00382429 predicted 710
4 SASI_Rn02_00382430 predicted 583
5 SASI_Rn02_00382431 predicted 243
6 SASI_Rn02_00382432 predicted 772
7 SASI_Rn02_00382433 predicted 534
8 SASI_Rn02_00382434 predicted 549
9 SASI_Rn02_00382435 predicted 825
10 SASI_Rn02_00382436 predicted 718
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173189 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00201246 predicted 766
2 SASI_Mm01_00201247 predicted 2630
3 SASI_Mm01_00201248 predicted 2204
4 SASI_Mm01_00201249 predicted 727
5 SASI_Mm01_00201250 predicted 1802
6 SASI_Mm02_00345160 predicted 1297
7 SASI_Mm01_00201251 predicted 1727
8 SASI_Mm01_00201252 predicted 1668
9 SASI_Mm01_00201253 predicted 1167
10 SASI_Mm01_00201254 predicted 687
11 SASI_Mm01_00201255 predicted 1053
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024596
MCPH1 MISSION shRNA Bacterial Glycerol Stock
microcephalin 1
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000426642    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024596.3-823s21c1
Sequence:CCGGGAAGTTGGAAGGATCCATTAACTCGAGTTAATGGATCCTTCCAACTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423827    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024596.3-370s21c1
Sequence:CCGGACACTTATCAAGCCTAATTAACTCGAGTTAATTAGGCTTGATAAGTGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083787    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024596.1-37s1c1
Sequence:CCGGCGTAAATGTATGCAGCCCAAACTCGAGTTTGGGCTGCATACATTTACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083783    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024596.1-2350s1c1
Sequence:CCGGGCCATGTGTTGTGGTTCTTAACTCGAGTTAAGAACCACAACACATGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083784    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024596.1-238s1c1
Sequence:CCGGGCAATGGAGAAGAGATTACAACTCGAGTTGTAATCTCTTCTCCATTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083786    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024596.1-685s1c1
Sequence:CCGGGAGACGTTTGAAGAGAAGTATCTCGAGATACTTCTCTTCAAACGTCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083785    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024596.1-1650s1c1
Sequence:CCGGGCCAACAAGAACATTAGTCATCTCGAGATGACTAATGTTCTTGTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024596
MCPH1 MISSION shRNA shRNA Plasmid DNA
microcephalin 1
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000426642    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024596.3-823s21c1
Sequence:CCGGGAAGTTGGAAGGATCCATTAACTCGAGTTAATGGATCCTTCCAACTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000423827    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024596.3-370s21c1
Sequence:CCGGACACTTATCAAGCCTAATTAACTCGAGTTAATTAGGCTTGATAAGTGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000083787    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024596.1-37s1c1
Sequence:CCGGCGTAAATGTATGCAGCCCAAACTCGAGTTTGGGCTGCATACATTTACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000083783    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024596.1-2350s1c1
Sequence:CCGGGCCATGTGTTGTGGTTCTTAACTCGAGTTAAGAACCACAACACATGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000083784    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024596.1-238s1c1
Sequence:CCGGGCAATGGAGAAGAGATTACAACTCGAGTTGTAATCTCTTCTCCATTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000083786    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024596.1-685s1c1
Sequence:CCGGGAGACGTTTGAAGAGAAGTATCTCGAGATACTTCTCTTCAAACGTCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000083785    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024596.1-1650s1c1
Sequence:CCGGGCCAACAAGAACATTAGTCATCTCGAGATGACTAATGTTCTTGTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024596
MCPH1 MISSION shRNA Lentiviral Transduction Particles
microcephalin 1
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000426642    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024596.3-823s21c1
Sequence:CCGGGAAGTTGGAAGGATCCATTAACTCGAGTTAATGGATCCTTCCAACTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423827    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024596.3-370s21c1
Sequence:CCGGACACTTATCAAGCCTAATTAACTCGAGTTAATTAGGCTTGATAAGTGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083787    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024596.1-37s1c1
Sequence:CCGGCGTAAATGTATGCAGCCCAAACTCGAGTTTGGGCTGCATACATTTACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083783    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024596.1-2350s1c1
Sequence:CCGGGCCATGTGTTGTGGTTCTTAACTCGAGTTAAGAACCACAACACATGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083784    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024596.1-238s1c1
Sequence:CCGGGCAATGGAGAAGAGATTACAACTCGAGTTGTAATCTCTTCTCCATTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083786    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024596.1-685s1c1
Sequence:CCGGGAGACGTTTGAAGAGAAGTATCTCGAGATACTTCTCTTCAAACGTCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083785    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024596.1-1650s1c1
Sequence:CCGGGCCAACAAGAACATTAGTCATCTCGAGATGACTAATGTTCTTGTTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_173189
VALIDATED
MCPH1 MISSION shRNA Bacterial Glycerol Stock
microcephalin 1
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000242050    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173189.2-1403s21c1
Sequence:CCGGCTCCTACGATGTCCATCATAGCTCGAGCTATGATGGACATCGTAGGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242052    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173189.2-1113s21c1
Sequence:CCGGCCACTCATCTTTCGGTGATTCCTCGAGGAATCACCGAAAGATGAGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242053    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_173189.2-691s21c1
Sequence:CCGGGCACTTGTTGATGAGTCTTTGCTCGAGCAAAGACTCATCAACAAGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242051    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173189.2-3285s21c1
Sequence:CCGGAGATACTTGTTCCCAATTATACTCGAGTATAATTGGGAACAAGTATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242049    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173189.2-2602s21c1
Sequence:CCGGTGCCGACTTGAACGCCATTTACTCGAGTAAATGGCGTTCAAGTCGGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000201304    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173189.2-718s1c1
Sequence:CCGGGCAGTGAATACCGATGAACATCTCGAGATGTTCATCGGTATTCACTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000189764    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173189.2-2319s1c1
Sequence:CCGGGCCAACGAGAACATTGGTCATCTCGAGATGACCAATGTTCTCGTTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_173189
VALIDATED
MCPH1 MISSION shRNA shRNA Plasmid DNA
microcephalin 1
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000242050    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173189.2-1403s21c1
Sequence:CCGGCTCCTACGATGTCCATCATAGCTCGAGCTATGATGGACATCGTAGGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000242052    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173189.2-1113s21c1
Sequence:CCGGCCACTCATCTTTCGGTGATTCCTCGAGGAATCACCGAAAGATGAGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000242053    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_173189.2-691s21c1
Sequence:CCGGGCACTTGTTGATGAGTCTTTGCTCGAGCAAAGACTCATCAACAAGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000242051    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173189.2-3285s21c1
Sequence:CCGGAGATACTTGTTCCCAATTATACTCGAGTATAATTGGGAACAAGTATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000242049    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173189.2-2602s21c1
Sequence:CCGGTGCCGACTTGAACGCCATTTACTCGAGTAAATGGCGTTCAAGTCGGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000201304    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173189.2-718s1c1
Sequence:CCGGGCAGTGAATACCGATGAACATCTCGAGATGTTCATCGGTATTCACTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000189764    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173189.2-2319s1c1
Sequence:CCGGGCCAACGAGAACATTGGTCATCTCGAGATGACCAATGTTCTCGTTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_173189
VALIDATED
MCPH1 MISSION shRNA Lentiviral Transduction Particles
microcephalin 1
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000242050    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173189.2-1403s21c1
Sequence:CCGGCTCCTACGATGTCCATCATAGCTCGAGCTATGATGGACATCGTAGGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242052    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173189.2-1113s21c1
Sequence:CCGGCCACTCATCTTTCGGTGATTCCTCGAGGAATCACCGAAAGATGAGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242053    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_173189.2-691s21c1
Sequence:CCGGGCACTTGTTGATGAGTCTTTGCTCGAGCAAAGACTCATCAACAAGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242051    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173189.2-3285s21c1
Sequence:CCGGAGATACTTGTTCCCAATTATACTCGAGTATAATTGGGAACAAGTATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242049    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173189.2-2602s21c1
Sequence:CCGGTGCCGACTTGAACGCCATTTACTCGAGTAAATGGCGTTCAAGTCGGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000201304    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173189.2-718s1c1
Sequence:CCGGGCAGTGAATACCGATGAACATCTCGAGATGTTCATCGGTATTCACTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000189764    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173189.2-2319s1c1
Sequence:CCGGGCCAACGAGAACATTGGTCATCTCGAGATGACCAATGTTCTCGTTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)