EMAIL THIS PAGE TO A FRIEND

MCRS1

microspherule protein 1

59 Gene Product Result for
Synonyms: ICP22BP INO80Q MCRS2 MSP58 P78
UniProtKB ID: Q96EZ8, O14742, O75497, Q6VN53
Gene ID:
Mouse(51812) microspherule protein 1
Rat(300222) microspherule protein 1
Zebrafish(406557) microspherule protein 1
cow(514410) microspherule protein 1
Horse(100051964) microspherule protein 1
domestic cat(101083525) microspherule protein 1
dog(477616) microspherule protein 1
chicken(426664) microspherule protein 1
sheep(101123364) microspherule protein 1
domestic guinea pig(100724960) microspherule protein 1
naked mole-rat(101710763) microspherule protein 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016766 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_016766 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_016766 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_006337 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006337 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006337 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001012300 Rosetta Predictions human pricing
NM_006337 Rosetta Predictions human pricing
NM_001013106 Rosetta Predictions rat pricing
NM_016766 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012300 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00173286 predicted 447
2 SASI_Hs01_00173287 predicted 1348
3 SASI_Hs01_00173289 predicted 1488
4 SASI_Hs01_00173290 predicted 1143
5 SASI_Hs02_00306072 predicted 375
6 SASI_Hs01_00173291 predicted 1012
7 SASI_Hs01_00173292 predicted 1534
8 SASI_Hs01_00173293 predicted 1106
9 SASI_Hs01_00173294 predicted 649
10 SASI_Hs01_00173295 predicted 886
11 SASI_Hs01_00173288 predicted 556
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006337 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00086700 predicted 603
2 SASI_Hs01_00086701 predicted 1504
3 SASI_Hs01_00086703 predicted 1648
4 SASI_Hs01_00086704 predicted 1296
5 SASI_Hs02_00341373 predicted 525
6 SASI_Hs01_00086705 predicted 1168
7 SASI_Hs01_00086706 predicted 1677
8 SASI_Hs01_00086707 predicted 1251
9 SASI_Hs01_00086708 predicted 801
10 SASI_Hs01_00086709 predicted 1037
11 SASI_Hs01_00086702 predicted 711
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013106 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00200780 predicted 1488
2 SASI_Rn02_00200781 predicted 762
3 SASI_Rn02_00200782 predicted 592
4 SASI_Rn02_00200783 predicted 1291
5 SASI_Rn02_00200784 predicted 291
6 SASI_Rn02_00200785 predicted 1251
7 SASI_Rn02_00200786 predicted 1373
8 SASI_Rn02_00200787 predicted 624
9 SASI_Rn02_00200788 predicted 204
10 SASI_Rn02_00200789 predicted 1347
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016766 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00124703 predicted 1262
2 SASI_Mm01_00124704 predicted 479
3 SASI_Mm01_00124705 predicted 1387
4 SASI_Mm01_00124706 predicted 635
5 SASI_Mm01_00124707 predicted 1472
6 SASI_Mm01_00124708 predicted 1342
7 SASI_Mm01_00124709 predicted 1503
8 SASI_Mm01_00124710 predicted 1155
9 SASI_Mm02_00323527 predicted 1253
10 SASI_Mm01_00124711 predicted 1623
11 SASI_Mm01_00124702 predicted 1365
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016766
VALIDATED
MCRS1 MISSION shRNA Bacterial Glycerol Stock
microspherule protein 1
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000176378    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016766.2-1023s1c1
Sequence:CCGGCAAGTGCTCAACTTCTCAGATCTCGAGATCTGAGAAGTTGAGCACTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175750    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016766.2-1364s1c1
Sequence:CCGGGCAAGGTGTCATCAAGTTGAACTCGAGTTCAACTTGATGACACCTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174480    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016766.2-963s1c1
Sequence:CCGGCTCATGAAACAGTATTACCTACTCGAGTAGGTAATACTGTTTCATGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174748    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016766.2-959s1c1
Sequence:CCGGGCAGCTCATGAAACAGTATTACTCGAGTAATACTGTTTCATGAGCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000351118    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016766.2-1023s21c1
Sequence:CCGGCAAGTGCTCAACTTCTCAGATCTCGAGATCTGAGAAGTTGAGCACTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000340196    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016766.2-959s21c1
Sequence:CCGGGCAGCTCATGAAACAGTATTACTCGAGTAATACTGTTTCATGAGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000340197    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016766.2-1364s21c1
Sequence:CCGGGCAAGGTGTCATCAAGTTGAACTCGAGTTCAACTTGATGACACCTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000351056    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016766.2-1603s21c1
Sequence:CCGGGCATTCTCCAGCCTCAGTTTCCTCGAGGAAACTGAGGCTGGAGAATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016766
VALIDATED
MCRS1 MISSION shRNA shRNA Plasmid DNA
microspherule protein 1
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000176378    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016766.2-1023s1c1
Sequence:CCGGCAAGTGCTCAACTTCTCAGATCTCGAGATCTGAGAAGTTGAGCACTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000175750    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016766.2-1364s1c1
Sequence:CCGGGCAAGGTGTCATCAAGTTGAACTCGAGTTCAACTTGATGACACCTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000174480    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016766.2-963s1c1
Sequence:CCGGCTCATGAAACAGTATTACCTACTCGAGTAGGTAATACTGTTTCATGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000174748    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016766.2-959s1c1
Sequence:CCGGGCAGCTCATGAAACAGTATTACTCGAGTAATACTGTTTCATGAGCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000351118    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016766.2-1023s21c1
Sequence:CCGGCAAGTGCTCAACTTCTCAGATCTCGAGATCTGAGAAGTTGAGCACTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000340196    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016766.2-959s21c1
Sequence:CCGGGCAGCTCATGAAACAGTATTACTCGAGTAATACTGTTTCATGAGCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000340197    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016766.2-1364s21c1
Sequence:CCGGGCAAGGTGTCATCAAGTTGAACTCGAGTTCAACTTGATGACACCTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000351056    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016766.2-1603s21c1
Sequence:CCGGGCATTCTCCAGCCTCAGTTTCCTCGAGGAAACTGAGGCTGGAGAATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016766
VALIDATED
MCRS1 MISSION shRNA Lentiviral Transduction Particles
microspherule protein 1
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000176378    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016766.2-1023s1c1
Sequence:CCGGCAAGTGCTCAACTTCTCAGATCTCGAGATCTGAGAAGTTGAGCACTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175750    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016766.2-1364s1c1
Sequence:CCGGGCAAGGTGTCATCAAGTTGAACTCGAGTTCAACTTGATGACACCTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174480    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016766.2-963s1c1
Sequence:CCGGCTCATGAAACAGTATTACCTACTCGAGTAGGTAATACTGTTTCATGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174748    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016766.2-959s1c1
Sequence:CCGGGCAGCTCATGAAACAGTATTACTCGAGTAATACTGTTTCATGAGCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000351118    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016766.2-1023s21c1
Sequence:CCGGCAAGTGCTCAACTTCTCAGATCTCGAGATCTGAGAAGTTGAGCACTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000340196    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016766.2-959s21c1
Sequence:CCGGGCAGCTCATGAAACAGTATTACTCGAGTAATACTGTTTCATGAGCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000340197    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016766.2-1364s21c1
Sequence:CCGGGCAAGGTGTCATCAAGTTGAACTCGAGTTCAACTTGATGACACCTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000351056    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016766.2-1603s21c1
Sequence:CCGGGCATTCTCCAGCCTCAGTTTCCTCGAGGAAACTGAGGCTGGAGAATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006337
VALIDATED
MCRS1 MISSION shRNA Bacterial Glycerol Stock
microspherule protein 1
Human
15 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000143831    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006337.3-338s1c1
Sequence:CCGGCAGGTTCATCAAGAGGAAGAACTCGAGTTCTTCCTCTTGATGAACCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139023    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006337.3-1475s1c1
Sequence:CCGGCAACAACTCTGTGGTGGAGATCTCGAGATCTCCACCACAGAGTTGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139523    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006337.3-1355s1c1
Sequence:CCGGCCGGAAACAAGGTGTCATCAACTCGAGTTGATGACACCTTGTTTCCGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140128    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006337.3-1025s1c1
Sequence:CCGGGCTGAACTTCTCTGATGCAGACTCGAGTCTGCATCAGAGAAGTTCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140629    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006337.3-965s1c1
Sequence:CCGGGAAGCAGTATTACCTGCTGGACTCGAGTCCAGCAGGTAATACTGCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142897    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_006337.3-463s1c1
Sequence:CCGGCCAGTGAGAAGAAGAAGGTATCTCGAGATACCTTCTTCTTCTCACTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142912    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_006337.3-1020s1c1
Sequence:CCGGCAAGTGCTGAACTTCTCTGATCTCGAGATCAGAGAAGTTCAGCACTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142955    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_006337.3-347s1c1
Sequence:CCGGCAAGAGGAAGAAGTTCGATGACTCGAGTCATCGAACTTCTTCCTCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122775    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006337.3-1502s1c1
Sequence:CCGGCCTGCGATTCGTCTTCCTTATCTCGAGATAAGGAAGACGAATCGCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122706    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006337.3-538s1c1
Sequence:CCGGCCAAGCGTGTGAAGAAGAGTACTCGAGTACTCTTCTTCACACGCTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000292333    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006337.3-347s21c1
Sequence:CCGGCAAGAGGAAGAAGTTCGATGACTCGAGTCATCGAACTTCTTCCTCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000297975    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006337.3-538s21c1
Sequence:CCGGCCAAGCGTGTGAAGAAGAGTACTCGAGTACTCTTCTTCACACGCTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000292330    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006337.3-1502s21c1
Sequence:CCGGCCTGCGATTCGTCTTCCTTATCTCGAGATAAGGAAGACGAATCGCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000292332    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006337.3-463s21c1
Sequence:CCGGCCAGTGAGAAGAAGAAGGTATCTCGAGATACCTTCTTCTTCTCACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000292331    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006337.3-1020s21c1
Sequence:CCGGCAAGTGCTGAACTTCTCTGATCTCGAGATCAGAGAAGTTCAGCACTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006337
VALIDATED
MCRS1 MISSION shRNA shRNA Plasmid DNA
microspherule protein 1
Human
15 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000143831    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006337.3-338s1c1
Sequence:CCGGCAGGTTCATCAAGAGGAAGAACTCGAGTTCTTCCTCTTGATGAACCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000139023    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006337.3-1475s1c1
Sequence:CCGGCAACAACTCTGTGGTGGAGATCTCGAGATCTCCACCACAGAGTTGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000139523    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006337.3-1355s1c1
Sequence:CCGGCCGGAAACAAGGTGTCATCAACTCGAGTTGATGACACCTTGTTTCCGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000140128    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006337.3-1025s1c1
Sequence:CCGGGCTGAACTTCTCTGATGCAGACTCGAGTCTGCATCAGAGAAGTTCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000140629    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006337.3-965s1c1
Sequence:CCGGGAAGCAGTATTACCTGCTGGACTCGAGTCCAGCAGGTAATACTGCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000142897    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_006337.3-463s1c1
Sequence:CCGGCCAGTGAGAAGAAGAAGGTATCTCGAGATACCTTCTTCTTCTCACTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000142912    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_006337.3-1020s1c1
Sequence:CCGGCAAGTGCTGAACTTCTCTGATCTCGAGATCAGAGAAGTTCAGCACTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000142955    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_006337.3-347s1c1
Sequence:CCGGCAAGAGGAAGAAGTTCGATGACTCGAGTCATCGAACTTCTTCCTCTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000122775    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006337.3-1502s1c1
Sequence:CCGGCCTGCGATTCGTCTTCCTTATCTCGAGATAAGGAAGACGAATCGCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000122706    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006337.3-538s1c1
Sequence:CCGGCCAAGCGTGTGAAGAAGAGTACTCGAGTACTCTTCTTCACACGCTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000292333    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006337.3-347s21c1
Sequence:CCGGCAAGAGGAAGAAGTTCGATGACTCGAGTCATCGAACTTCTTCCTCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000297975    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006337.3-538s21c1
Sequence:CCGGCCAAGCGTGTGAAGAAGAGTACTCGAGTACTCTTCTTCACACGCTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000292330    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006337.3-1502s21c1
Sequence:CCGGCCTGCGATTCGTCTTCCTTATCTCGAGATAAGGAAGACGAATCGCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000292332    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006337.3-463s21c1
Sequence:CCGGCCAGTGAGAAGAAGAAGGTATCTCGAGATACCTTCTTCTTCTCACTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000292331    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006337.3-1020s21c1
Sequence:CCGGCAAGTGCTGAACTTCTCTGATCTCGAGATCAGAGAAGTTCAGCACTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006337
VALIDATED
MCRS1 MISSION shRNA Lentiviral Transduction Particles
microspherule protein 1
Human
15 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000143831    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006337.3-338s1c1
Sequence:CCGGCAGGTTCATCAAGAGGAAGAACTCGAGTTCTTCCTCTTGATGAACCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139023    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006337.3-1475s1c1
Sequence:CCGGCAACAACTCTGTGGTGGAGATCTCGAGATCTCCACCACAGAGTTGTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139523    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006337.3-1355s1c1
Sequence:CCGGCCGGAAACAAGGTGTCATCAACTCGAGTTGATGACACCTTGTTTCCGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140128    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006337.3-1025s1c1
Sequence:CCGGGCTGAACTTCTCTGATGCAGACTCGAGTCTGCATCAGAGAAGTTCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140629    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006337.3-965s1c1
Sequence:CCGGGAAGCAGTATTACCTGCTGGACTCGAGTCCAGCAGGTAATACTGCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142897    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_006337.3-463s1c1
Sequence:CCGGCCAGTGAGAAGAAGAAGGTATCTCGAGATACCTTCTTCTTCTCACTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142912    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_006337.3-1020s1c1
Sequence:CCGGCAAGTGCTGAACTTCTCTGATCTCGAGATCAGAGAAGTTCAGCACTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142955    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_006337.3-347s1c1
Sequence:CCGGCAAGAGGAAGAAGTTCGATGACTCGAGTCATCGAACTTCTTCCTCTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122775    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006337.3-1502s1c1
Sequence:CCGGCCTGCGATTCGTCTTCCTTATCTCGAGATAAGGAAGACGAATCGCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122706    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006337.3-538s1c1
Sequence:CCGGCCAAGCGTGTGAAGAAGAGTACTCGAGTACTCTTCTTCACACGCTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000292333    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006337.3-347s21c1
Sequence:CCGGCAAGAGGAAGAAGTTCGATGACTCGAGTCATCGAACTTCTTCCTCTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000297975    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006337.3-538s21c1
Sequence:CCGGCCAAGCGTGTGAAGAAGAGTACTCGAGTACTCTTCTTCACACGCTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000292330    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006337.3-1502s21c1
Sequence:CCGGCCTGCGATTCGTCTTCCTTATCTCGAGATAAGGAAGACGAATCGCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000292332    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006337.3-463s21c1
Sequence:CCGGCCAGTGAGAAGAAGAAGGTATCTCGAGATACCTTCTTCTTCTCACTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000292331    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006337.3-1020s21c1
Sequence:CCGGCAAGTGCTGAACTTCTCTGATCTCGAGATCAGAGAAGTTCAGCACTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)