EMAIL THIS PAGE TO A FRIEND

MCTP2

multiple C2 domains, transmembrane 2

59 Gene Product Result for
Gene ID:
Mouse(244049) multiple C2 domains, transmembrane 2
Rat(308742) multiple C2 domains, transmembrane 2
naked mole-rat(101714064) multiple C2 domains, transmembrane 2
Domestic Rabbit(100347093) multiple C2 domains, transmembrane 2
domestic guinea pig(100712765) multiple C2 domains, transmembrane 2
sheep(101119255) multiple C2 domains, transmembrane 2
chicken(415508) multiple C2 domains, transmembrane 2
dog(488717) multiple C2 domains, transmembrane 2
domestic cat(101096813) multiple C2 domains, transmembrane 2
Horse(100049873) multiple C2 domains, transmembrane 2
cow(532150) multiple C2 domains, transmembrane 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_145693 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_145693 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_145693 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_018349 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018349 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018349 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001024703 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001024703 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001024703 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018349 Rosetta Predictions human pricing
XM_001061950 Rosetta Predictions rat pricing
XM_218795 Rosetta Predictions rat pricing
NM_001024703 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018349 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00047315 predicted 1969
2 SASI_Hs01_00047316 predicted 2071
3 SASI_Hs02_00351804 predicted 2137
4 SASI_Hs01_00047317 predicted 732
5 SASI_Hs01_00047318 predicted 1795
6 SASI_Hs02_00351805 predicted 1653
7 SASI_Hs01_00047320 predicted 2236
8 SASI_Hs01_00047322 predicted 1051
9 SASI_Hs01_00047323 predicted 1851
10 SASI_Hs01_00047324 predicted 1596
11 SASI_Hs01_00047319 predicted 1389
12 SASI_Hs01_00047321 predicted 1522
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001061950 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00301888 predicted 1972
2 SASI_Rn02_00301889 predicted 770
3 SASI_Rn02_00301890 predicted 706
4 SASI_Rn02_00301891 predicted 720
5 SASI_Rn02_00301892 predicted 1182
6 SASI_Rn02_00301893 predicted 1777
7 SASI_Rn02_00301894 predicted 517
8 SASI_Rn02_00301895 predicted 1803
9 SASI_Rn02_00301896 predicted 935
10 SASI_Rn02_00301897 predicted 947
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_218795 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00378062 predicted 1979
2 SASI_Rn02_00378063 predicted 772
3 SASI_Rn02_00378064 predicted 702
4 SASI_Rn02_00378065 predicted 720
5 SASI_Rn02_00378066 predicted 1187
6 SASI_Rn02_00378067 predicted 1778
7 SASI_Rn02_00378068 predicted 520
8 SASI_Rn02_00378069 predicted 1808
9 SASI_Rn02_00378070 predicted 936
10 SASI_Rn02_00378071 predicted 947
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001024703 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00067344 predicted 978
2 SASI_Mm01_00067345 predicted 2601
3 SASI_Mm01_00067346 predicted 1310
4 SASI_Mm01_00067347 predicted 934
5 SASI_Mm01_00067348 predicted 1391
6 SASI_Mm01_00067349 predicted 1716
7 SASI_Mm01_00067350 predicted 2453
8 SASI_Mm01_00067351 predicted 1154
9 SASI_Mm01_00067352 predicted 1259
10 SASI_Mm01_00067353 predicted 1158
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_145693
VALIDATED
MCTP2 MISSION shRNA Bacterial Glycerol Stock
multiple C2 domains, transmembrane 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000028277    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_145693.2-215s1c1
Sequence:CCGGCCAGTGAAAGACAGCAGATTTCTCGAGAAATCTGCTGTCTTTCACTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028280    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_145693.2-1027s1c1
Sequence:CCGGCGTGGTTGTGATCTTTCCTTTCTCGAGAAAGGAAAGATCACAACCACGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028257    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_145693.2-1411s1c1
Sequence:CCGGCCTTATTCCATCGACAATAATCTCGAGATTATTGTCGATGGAATAAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028228    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_145693.2-633s1c1
Sequence:CCGGCCTCATATATAATCCGGTCAACTCGAGTTGACCGGATTATATATGAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028250    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_145693.2-1306s1c1
Sequence:CCGGGCCTGTTTGATTCTGGCCATACTCGAGTATGGCCAGAATCAAACAGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_145693
VALIDATED
MCTP2 MISSION shRNA shRNA Plasmid DNA
multiple C2 domains, transmembrane 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000028277    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_145693.2-215s1c1
Sequence:CCGGCCAGTGAAAGACAGCAGATTTCTCGAGAAATCTGCTGTCTTTCACTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000028280    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_145693.2-1027s1c1
Sequence:CCGGCGTGGTTGTGATCTTTCCTTTCTCGAGAAAGGAAAGATCACAACCACGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000028257    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_145693.2-1411s1c1
Sequence:CCGGCCTTATTCCATCGACAATAATCTCGAGATTATTGTCGATGGAATAAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000028228    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_145693.2-633s1c1
Sequence:CCGGCCTCATATATAATCCGGTCAACTCGAGTTGACCGGATTATATATGAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000028250    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_145693.2-1306s1c1
Sequence:CCGGGCCTGTTTGATTCTGGCCATACTCGAGTATGGCCAGAATCAAACAGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_145693
VALIDATED
MCTP2 MISSION shRNA Lentiviral Transduction Particles
multiple C2 domains, transmembrane 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000028277    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_145693.2-215s1c1
Sequence:CCGGCCAGTGAAAGACAGCAGATTTCTCGAGAAATCTGCTGTCTTTCACTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028280    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_145693.2-1027s1c1
Sequence:CCGGCGTGGTTGTGATCTTTCCTTTCTCGAGAAAGGAAAGATCACAACCACGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028257    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_145693.2-1411s1c1
Sequence:CCGGCCTTATTCCATCGACAATAATCTCGAGATTATTGTCGATGGAATAAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028228    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_145693.2-633s1c1
Sequence:CCGGCCTCATATATAATCCGGTCAACTCGAGTTGACCGGATTATATATGAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028250    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_145693.2-1306s1c1
Sequence:CCGGGCCTGTTTGATTCTGGCCATACTCGAGTATGGCCAGAATCAAACAGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018349
MCTP2 MISSION shRNA Bacterial Glycerol Stock
multiple C2 domains, transmembrane 2
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000007119    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018349.1-361s1c1
Sequence:CCGGCGTCGGCATTCTACAAGTGAACTCGAGTTCACTTGTAGAATGCCGACGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007117    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018349.1-2205s1c1
Sequence:CCGGCCACTTCTTCTCACTTTACTTCTCGAGAAGTAAAGTGAGAAGAAGTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007120    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018349.1-715s1c1
Sequence:CCGGCCTTATATATAATCCGGTGAACTCGAGTTCACCGGATTATATATAAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007121    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018349.1-221s1c1
Sequence:CCGGCTCCTTATGTTGGTCACACTTCTCGAGAAGTGTGACCAACATAAGGAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428979    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018349.3-842s21c1
Sequence:CCGGGAAGGTATATGATCGAGATTTCTCGAGAAATCTCGATCATATACCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007118    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018349.1-1343s1c1
Sequence:CCGGCCCTATTCCATCGACAATAATCTCGAGATTATTGTCGATGGAATAGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421895    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018349.3-1535s21c1
Sequence:CCGGGCAGATTACCCAGCGATATTGCTCGAGCAATATCGCTGGGTAATCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421406    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018349.3-1353s21c1
Sequence:CCGGGAACGTCTGGGCACGTGTAAACTCGAGTTTACACGTGCCCAGACGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421503    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018349.3-973s21c1
Sequence:CCGGACATGGGAGTGATCGTGTTAACTCGAGTTAACACGATCACTCCCATGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018349
MCTP2 MISSION shRNA shRNA Plasmid DNA
multiple C2 domains, transmembrane 2
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000007119    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018349.1-361s1c1
Sequence:CCGGCGTCGGCATTCTACAAGTGAACTCGAGTTCACTTGTAGAATGCCGACGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000007117    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018349.1-2205s1c1
Sequence:CCGGCCACTTCTTCTCACTTTACTTCTCGAGAAGTAAAGTGAGAAGAAGTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000007120    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018349.1-715s1c1
Sequence:CCGGCCTTATATATAATCCGGTGAACTCGAGTTCACCGGATTATATATAAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000007121    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018349.1-221s1c1
Sequence:CCGGCTCCTTATGTTGGTCACACTTCTCGAGAAGTGTGACCAACATAAGGAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000428979    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018349.3-842s21c1
Sequence:CCGGGAAGGTATATGATCGAGATTTCTCGAGAAATCTCGATCATATACCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000007118    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018349.1-1343s1c1
Sequence:CCGGCCCTATTCCATCGACAATAATCTCGAGATTATTGTCGATGGAATAGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000421895    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018349.3-1535s21c1
Sequence:CCGGGCAGATTACCCAGCGATATTGCTCGAGCAATATCGCTGGGTAATCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000421406    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018349.3-1353s21c1
Sequence:CCGGGAACGTCTGGGCACGTGTAAACTCGAGTTTACACGTGCCCAGACGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000421503    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018349.3-973s21c1
Sequence:CCGGACATGGGAGTGATCGTGTTAACTCGAGTTAACACGATCACTCCCATGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018349
MCTP2 MISSION shRNA Lentiviral Transduction Particles
multiple C2 domains, transmembrane 2
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000007119    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018349.1-361s1c1
Sequence:CCGGCGTCGGCATTCTACAAGTGAACTCGAGTTCACTTGTAGAATGCCGACGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007117    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018349.1-2205s1c1
Sequence:CCGGCCACTTCTTCTCACTTTACTTCTCGAGAAGTAAAGTGAGAAGAAGTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007120    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018349.1-715s1c1
Sequence:CCGGCCTTATATATAATCCGGTGAACTCGAGTTCACCGGATTATATATAAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007121    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018349.1-221s1c1
Sequence:CCGGCTCCTTATGTTGGTCACACTTCTCGAGAAGTGTGACCAACATAAGGAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428979    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018349.3-842s21c1
Sequence:CCGGGAAGGTATATGATCGAGATTTCTCGAGAAATCTCGATCATATACCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007118    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018349.1-1343s1c1
Sequence:CCGGCCCTATTCCATCGACAATAATCTCGAGATTATTGTCGATGGAATAGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421895    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018349.3-1535s21c1
Sequence:CCGGGCAGATTACCCAGCGATATTGCTCGAGCAATATCGCTGGGTAATCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421406    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018349.3-1353s21c1
Sequence:CCGGGAACGTCTGGGCACGTGTAAACTCGAGTTTACACGTGCCCAGACGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421503    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018349.3-973s21c1
Sequence:CCGGACATGGGAGTGATCGTGTTAACTCGAGTTAACACGATCACTCCCATGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001024703
MCTP2 MISSION shRNA Bacterial Glycerol Stock
multiple C2 domains, transmembrane 2
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000412248    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001024703.1-3058s21c1
Sequence:CCGGGAGACTGTGGGAGCTTCATATCTCGAGATATGAAGCTCCCACAGTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425947    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001024703.1-3176s21c1
Sequence:CCGGTTCAATACCTTCGACAGATTTCTCGAGAAATCTGTCGAAGGTATTGAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419035    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001024703.1-288s21c1
Sequence:CCGGCAAGCAAACCTTTGGATTTAACTCGAGTTAAATCCAAAGGTTTGCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432788    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001024703.1-546s21c1
Sequence:CCGGCCGACTCTGAAGAGATCTATGCTCGAGCATAGATCTCTTCAGAGTCGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434392    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001024703.1-1253s21c1
Sequence:CCGGTGGAATGGGATTATAAGTATACTCGAGTATACTTATAATCCCATTCCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414065    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001024703.1-2630s21c1
Sequence:CCGGTTCATCCCTCTACGGTATATCCTCGAGGATATACCGTAGAGGGATGAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419428    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001024703.1-897s21c1
Sequence:CCGGATAAGAACTTGAACCCAATTTCTCGAGAAATTGGGTTCAAGTTCTTATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426162    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001024703.1-1168s21c1
Sequence:CCGGGTCAAATCGGAAGCGGTTAAGCTCGAGCTTAACCGCTTCCGATTTGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425176    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001024703.1-1818s21c1
Sequence:CCGGGACTTCAGACACATACCATTTCTCGAGAAATGGTATGTGTCTGAAGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425813    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001024703.1-234s21c1
Sequence:CCGGAGCGAACCAGACCTTTGTTAACTCGAGTTAACAAAGGTCTGGTTCGCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427585    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001024703.1-972s21c1
Sequence:CCGGAGGTGTATGATCGAGACTTAACTCGAGTTAAGTCTCGATCATACACCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001024703
MCTP2 MISSION shRNA shRNA Plasmid DNA
multiple C2 domains, transmembrane 2
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000412248    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001024703.1-3058s21c1
Sequence:CCGGGAGACTGTGGGAGCTTCATATCTCGAGATATGAAGCTCCCACAGTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000425947    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001024703.1-3176s21c1
Sequence:CCGGTTCAATACCTTCGACAGATTTCTCGAGAAATCTGTCGAAGGTATTGAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000419035    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001024703.1-288s21c1
Sequence:CCGGCAAGCAAACCTTTGGATTTAACTCGAGTTAAATCCAAAGGTTTGCTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000432788    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001024703.1-546s21c1
Sequence:CCGGCCGACTCTGAAGAGATCTATGCTCGAGCATAGATCTCTTCAGAGTCGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000434392    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001024703.1-1253s21c1
Sequence:CCGGTGGAATGGGATTATAAGTATACTCGAGTATACTTATAATCCCATTCCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000414065    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001024703.1-2630s21c1
Sequence:CCGGTTCATCCCTCTACGGTATATCCTCGAGGATATACCGTAGAGGGATGAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000419428    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001024703.1-897s21c1
Sequence:CCGGATAAGAACTTGAACCCAATTTCTCGAGAAATTGGGTTCAAGTTCTTATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000426162    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001024703.1-1168s21c1
Sequence:CCGGGTCAAATCGGAAGCGGTTAAGCTCGAGCTTAACCGCTTCCGATTTGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000425176    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001024703.1-1818s21c1
Sequence:CCGGGACTTCAGACACATACCATTTCTCGAGAAATGGTATGTGTCTGAAGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000425813    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001024703.1-234s21c1
Sequence:CCGGAGCGAACCAGACCTTTGTTAACTCGAGTTAACAAAGGTCTGGTTCGCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000427585    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001024703.1-972s21c1
Sequence:CCGGAGGTGTATGATCGAGACTTAACTCGAGTTAAGTCTCGATCATACACCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001024703
MCTP2 MISSION shRNA Lentiviral Transduction Particles
multiple C2 domains, transmembrane 2
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000412248    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001024703.1-3058s21c1
Sequence:CCGGGAGACTGTGGGAGCTTCATATCTCGAGATATGAAGCTCCCACAGTCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425947    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001024703.1-3176s21c1
Sequence:CCGGTTCAATACCTTCGACAGATTTCTCGAGAAATCTGTCGAAGGTATTGAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419035    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001024703.1-288s21c1
Sequence:CCGGCAAGCAAACCTTTGGATTTAACTCGAGTTAAATCCAAAGGTTTGCTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432788    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001024703.1-546s21c1
Sequence:CCGGCCGACTCTGAAGAGATCTATGCTCGAGCATAGATCTCTTCAGAGTCGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434392    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001024703.1-1253s21c1
Sequence:CCGGTGGAATGGGATTATAAGTATACTCGAGTATACTTATAATCCCATTCCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414065    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001024703.1-2630s21c1
Sequence:CCGGTTCATCCCTCTACGGTATATCCTCGAGGATATACCGTAGAGGGATGAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419428    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001024703.1-897s21c1
Sequence:CCGGATAAGAACTTGAACCCAATTTCTCGAGAAATTGGGTTCAAGTTCTTATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426162    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001024703.1-1168s21c1
Sequence:CCGGGTCAAATCGGAAGCGGTTAAGCTCGAGCTTAACCGCTTCCGATTTGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425176    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001024703.1-1818s21c1
Sequence:CCGGGACTTCAGACACATACCATTTCTCGAGAAATGGTATGTGTCTGAAGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425813    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001024703.1-234s21c1
Sequence:CCGGAGCGAACCAGACCTTTGTTAACTCGAGTTAACAAAGGTCTGGTTCGCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427585    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001024703.1-972s21c1
Sequence:CCGGAGGTGTATGATCGAGACTTAACTCGAGTTAAGTCTCGATCATACACCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)