EMAIL THIS PAGE TO A FRIEND

MCTS1

malignant T cell amplified sequence 1

73 Gene Product Result for
Synonyms: MCT-1 MCT1
UniProtKB ID: Q9ULC4, B4DGY2, Q502X6
Gene ID:
Mouse(68995) malignant T cell amplified sequence 1
Rat(302500) malignant T cell amplified sequence 1
Zebrafish(394046) malignant T cell amplified sequence 1
cow(508412) malignant T cell amplified sequence 1
dog(481038) malignant T cell amplified sequence 1
domestic cat(101088064) malignant T cell amplified sequence 1
chicken(422363) malignant T cell amplified sequence 1
domestic guinea pig(100714461) malignant T cell amplified sequence 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014060 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014060 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014060 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_026902 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026902 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026902 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014060 Rosetta Predictions human pricing
NM_001044237 Rosetta Predictions rat pricing
NM_026902 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014060 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00145903 predicted 566
2 SASI_Hs01_00145906 predicted 680
3 SASI_Hs01_00145907 predicted 411
4 SASI_Hs01_00145910 predicted 326
5 SASI_Hs01_00145912 predicted 499
6 SASI_Hs02_00345079 predicted 435
7 SASI_Hs01_00145905 predicted 307
8 SASI_Hs01_00145908 predicted 530
9 SASI_Hs01_00145909 predicted 411
10 SASI_Hs01_00145911 predicted 595
11 SASI_Hs01_00145904 predicted 557
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001044237 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00205097 predicted 970
2 SASI_Rn02_00205098 predicted 835
3 SASI_Rn02_00205099 predicted 789
4 SASI_Rn02_00205100 predicted 600
5 SASI_Rn02_00205101 predicted 678
6 SASI_Rn02_00205102 predicted 578
7 SASI_Rn02_00205103 predicted 908
8 SASI_Rn02_00205104 predicted 781
9 SASI_Rn02_00205105 predicted 646
10 SASI_Rn02_00205106 predicted 819
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026902 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00140437 predicted 379
2 SASI_Mm01_00140440 predicted 238
3 SASI_Mm01_00140444 predicted 288
4 SASI_Mm01_00140438 predicted 641
5 SASI_Mm01_00140442 predicted 558
6 SASI_Mm01_00140443 predicted 630
7 SASI_Mm01_00140446 predicted 560
8 SASI_Mm02_00331174 predicted 390
9 SASI_Mm02_00331175 predicted 206
10 SASI_Mm02_00331176 predicted 238
11 SASI_Mm01_00140439 predicted 355
12 SASI_Mm01_00140441 predicted 424
13 SASI_Mm01_00140445 predicted 232
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014060
VALIDATED
MCTS1 MISSION shRNA Bacterial Glycerol Stock
malignant T cell amplified sequence 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000293869    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014060.2-903s21c1
Sequence:CCGGAGGAATGCACTTGGGCTAAATCTCGAGATTTAGCCCAAGTGCATTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000293825    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014060.2-505s21c1
Sequence:CCGGGTCCGATGCCATGAACATATACTCGAGTATATGTTCATGGCATCGGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286378    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014060.2-729s21c1
Sequence:CCGGAGTAGATACCATTGTTGCTATCTCGAGATAGCAACAATGGTATCTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000293823    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014060.2-660s21c1
Sequence:CCGGTGTACTCAGTGGAGCAAATATCTCGAGATATTTGCTCCACTGAGTACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000298208    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014060.2-590s21c1
Sequence:CCGGCCCTAAGATTACTTCACAAATCTCGAGATTTGTGAAGTAATCTTAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072286    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014060.1-638s1c1
Sequence:CCGGAGTAGATACCATTGTTGCTATCTCGAGATAGCAACAATGGTATCTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072283    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014060.1-499s1c1
Sequence:CCGGCCCTAAGATTACTTCACAAATCTCGAGATTTGTGAAGTAATCTTAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072284    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014060.1-374s1c1
Sequence:CCGGGCTTAATCAAATCATGCCTAACTCGAGTTAGGCATGATTTGATTAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072285    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014060.1-542s1c1
Sequence:CCGGGCAGGTTGATAAAGGAGCCATCTCGAGATGGCTCCTTTATCAACCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072287    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014060.1-601s1c1
Sequence:CCGGGCTTAACTTCTCCTGGAGCTACTCGAGTAGCTCCAGGAGAAGTTAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014060
VALIDATED
MCTS1 MISSION shRNA shRNA Plasmid DNA
malignant T cell amplified sequence 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000293869    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014060.2-903s21c1
Sequence:CCGGAGGAATGCACTTGGGCTAAATCTCGAGATTTAGCCCAAGTGCATTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000293825    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014060.2-505s21c1
Sequence:CCGGGTCCGATGCCATGAACATATACTCGAGTATATGTTCATGGCATCGGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000286378    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014060.2-729s21c1
Sequence:CCGGAGTAGATACCATTGTTGCTATCTCGAGATAGCAACAATGGTATCTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000293823    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014060.2-660s21c1
Sequence:CCGGTGTACTCAGTGGAGCAAATATCTCGAGATATTTGCTCCACTGAGTACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000298208    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014060.2-590s21c1
Sequence:CCGGCCCTAAGATTACTTCACAAATCTCGAGATTTGTGAAGTAATCTTAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000072286    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014060.1-638s1c1
Sequence:CCGGAGTAGATACCATTGTTGCTATCTCGAGATAGCAACAATGGTATCTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000072283    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014060.1-499s1c1
Sequence:CCGGCCCTAAGATTACTTCACAAATCTCGAGATTTGTGAAGTAATCTTAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000072284    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014060.1-374s1c1
Sequence:CCGGGCTTAATCAAATCATGCCTAACTCGAGTTAGGCATGATTTGATTAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000072285    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014060.1-542s1c1
Sequence:CCGGGCAGGTTGATAAAGGAGCCATCTCGAGATGGCTCCTTTATCAACCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000072287    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014060.1-601s1c1
Sequence:CCGGGCTTAACTTCTCCTGGAGCTACTCGAGTAGCTCCAGGAGAAGTTAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014060
VALIDATED
MCTS1 MISSION shRNA Lentiviral Transduction Particles
malignant T cell amplified sequence 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000293869    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014060.2-903s21c1
Sequence:CCGGAGGAATGCACTTGGGCTAAATCTCGAGATTTAGCCCAAGTGCATTCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000293825    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014060.2-505s21c1
Sequence:CCGGGTCCGATGCCATGAACATATACTCGAGTATATGTTCATGGCATCGGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286378    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014060.2-729s21c1
Sequence:CCGGAGTAGATACCATTGTTGCTATCTCGAGATAGCAACAATGGTATCTACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000293823    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014060.2-660s21c1
Sequence:CCGGTGTACTCAGTGGAGCAAATATCTCGAGATATTTGCTCCACTGAGTACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000298208    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014060.2-590s21c1
Sequence:CCGGCCCTAAGATTACTTCACAAATCTCGAGATTTGTGAAGTAATCTTAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072286    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014060.1-638s1c1
Sequence:CCGGAGTAGATACCATTGTTGCTATCTCGAGATAGCAACAATGGTATCTACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072283    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014060.1-499s1c1
Sequence:CCGGCCCTAAGATTACTTCACAAATCTCGAGATTTGTGAAGTAATCTTAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072284    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014060.1-374s1c1
Sequence:CCGGGCTTAATCAAATCATGCCTAACTCGAGTTAGGCATGATTTGATTAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072285    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014060.1-542s1c1
Sequence:CCGGGCAGGTTGATAAAGGAGCCATCTCGAGATGGCTCCTTTATCAACCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072287    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014060.1-601s1c1
Sequence:CCGGGCTTAACTTCTCCTGGAGCTACTCGAGTAGCTCCAGGAGAAGTTAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026902
VALIDATED
MCTS1 MISSION shRNA Bacterial Glycerol Stock
malignant T cell amplified sequence 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000257925    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_026902.3-213s21c1
Sequence:CCGGGGTATTGAACCATGGCTTAATCTCGAGATTAAGCCATGGTTCAATACCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249689    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026902.3-675s21c1
Sequence:CCGGATGGGCTAACTATGGATACTGCTCGAGCAGTATCCATAGTTAGCCCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249687    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026902.3-463s21c1
Sequence:CCGGCTCCCGGAGCTAAGCTTTATCCTCGAGGATAAAGCTTAGCTCCGGGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216554    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026902.3-567s1c1
Sequence:CCGGGAAGATATTGAGAAAGTAAACCTCGAGGTTTACTTTCTCAATATCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183978    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026902.1-456s1c1
Sequence:CCGGCTTAACTTCTCCCGGAGCTAACTCGAGTTAGCTCCGGGAGAAGTTAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000184634    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026902.1-211s1c1
Sequence:CCGGCCAGGTATTGAACCATGGCTTCTCGAGAAGCCATGGTTCAATACCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217784    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026902.3-387s1c1
Sequence:CCGGCCACATCAGCAGGTTGATAAACTCGAGTTTATCAACCTGCTGATGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249686    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_026902.3-286s21c1
Sequence:CCGGTAGAAATCCTTACAGTAAATGCTCGAGCATTTACTGTAAGGATTTCTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249688    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_026902.3-387s21c1
Sequence:CCGGCCACATCAGCAGGTTGATAAACTCGAGTTTATCAACCTGCTGATGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179772    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026902.1-727s1c1
Sequence:CCGGGCATGAAGACAAAGCCTCTATCTCGAGATAGAGGCTTTGTCTTCATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026902
VALIDATED
MCTS1 MISSION shRNA shRNA Plasmid DNA
malignant T cell amplified sequence 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000257925    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_026902.3-213s21c1
Sequence:CCGGGGTATTGAACCATGGCTTAATCTCGAGATTAAGCCATGGTTCAATACCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000249689    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026902.3-675s21c1
Sequence:CCGGATGGGCTAACTATGGATACTGCTCGAGCAGTATCCATAGTTAGCCCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000249687    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026902.3-463s21c1
Sequence:CCGGCTCCCGGAGCTAAGCTTTATCCTCGAGGATAAAGCTTAGCTCCGGGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000216554    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026902.3-567s1c1
Sequence:CCGGGAAGATATTGAGAAAGTAAACCTCGAGGTTTACTTTCTCAATATCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000183978    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026902.1-456s1c1
Sequence:CCGGCTTAACTTCTCCCGGAGCTAACTCGAGTTAGCTCCGGGAGAAGTTAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000184634    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026902.1-211s1c1
Sequence:CCGGCCAGGTATTGAACCATGGCTTCTCGAGAAGCCATGGTTCAATACCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000217784    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026902.3-387s1c1
Sequence:CCGGCCACATCAGCAGGTTGATAAACTCGAGTTTATCAACCTGCTGATGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000249686    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_026902.3-286s21c1
Sequence:CCGGTAGAAATCCTTACAGTAAATGCTCGAGCATTTACTGTAAGGATTTCTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000249688    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_026902.3-387s21c1
Sequence:CCGGCCACATCAGCAGGTTGATAAACTCGAGTTTATCAACCTGCTGATGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000179772    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026902.1-727s1c1
Sequence:CCGGGCATGAAGACAAAGCCTCTATCTCGAGATAGAGGCTTTGTCTTCATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026902
VALIDATED
MCTS1 MISSION shRNA Lentiviral Transduction Particles
malignant T cell amplified sequence 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000257925    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_026902.3-213s21c1
Sequence:CCGGGGTATTGAACCATGGCTTAATCTCGAGATTAAGCCATGGTTCAATACCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249689    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026902.3-675s21c1
Sequence:CCGGATGGGCTAACTATGGATACTGCTCGAGCAGTATCCATAGTTAGCCCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249687    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026902.3-463s21c1
Sequence:CCGGCTCCCGGAGCTAAGCTTTATCCTCGAGGATAAAGCTTAGCTCCGGGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216554    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026902.3-567s1c1
Sequence:CCGGGAAGATATTGAGAAAGTAAACCTCGAGGTTTACTTTCTCAATATCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183978    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026902.1-456s1c1
Sequence:CCGGCTTAACTTCTCCCGGAGCTAACTCGAGTTAGCTCCGGGAGAAGTTAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000184634    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026902.1-211s1c1
Sequence:CCGGCCAGGTATTGAACCATGGCTTCTCGAGAAGCCATGGTTCAATACCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217784    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026902.3-387s1c1
Sequence:CCGGCCACATCAGCAGGTTGATAAACTCGAGTTTATCAACCTGCTGATGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249686    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_026902.3-286s21c1
Sequence:CCGGTAGAAATCCTTACAGTAAATGCTCGAGCATTTACTGTAAGGATTTCTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249688    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_026902.3-387s21c1
Sequence:CCGGCCACATCAGCAGGTTGATAAACTCGAGTTTATCAACCTGCTGATGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179772    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026902.1-727s1c1
Sequence:CCGGGCATGAAGACAAAGCCTCTATCTCGAGATAGAGGCTTTGTCTTCATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)