EMAIL THIS PAGE TO A FRIEND

MCU

mitochondrial calcium uniporter

174 Gene Product Result for
Synonyms: C10orf42 CCDC109A
UniProtKB ID: Q8NE86, B2RDF3, B3KXV7, Q96FL3
Gene ID:
Human(90550) Summary: This gene encodes a calcium transporter that localizes to the mitochondrial inner membrane. The encoded protein interacts with mitochondrial calcium uptake 1. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2012]
Mouse(215999) mitochondrial calcium uniporter
Rat(294560) mitochondrial calcium uniporter
sheep(101115342) mitochondrial calcium uniporter
domestic guinea pig(100715815) mitochondrial calcium uniporter
naked mole-rat(101700272) mitochondrial calcium uniporter
Zebrafish(768182) mitochondrial calcium uniporter
cow(536656) mitochondrial calcium uniporter
domestic cat(101083455) mitochondrial calcium uniporter
dog(489042) mitochondrial calcium uniporter
chicken(428942) mitochondrial calcium uniporter
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_138357 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_138357 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_138357 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001033259 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001033259 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001033259 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_138357 Rosetta Predictions human pricing
NM_001106398 Rosetta Predictions rat pricing
NM_001033259 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138357 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00234628 predicted 1260
2 SASI_Hs01_00234629 predicted 808
3 SASI_Hs01_00234630 predicted 584
4 SASI_Hs01_00234631 predicted 777
5 SASI_Hs01_00234632 predicted 310
6 SASI_Hs01_00234633 predicted 675
7 SASI_Hs02_00363453 predicted 701
8 SASI_Hs01_00234634 predicted 1285
9 SASI_Hs01_00234635 predicted 1272
10 SASI_Hs01_00234636 predicted 557
11 SASI_Hs01_00234637 predicted 616
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106398 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00218568 predicted 761
2 SASI_Rn02_00218569 predicted 522
3 SASI_Rn02_00218570 predicted 1065
4 SASI_Rn02_00218571 predicted 302
5 SASI_Rn02_00218572 predicted 244
6 SASI_Rn02_00218573 predicted 279
7 SASI_Rn02_00218574 predicted 267
8 SASI_Rn02_00218575 predicted 365
9 SASI_Rn02_00218576 predicted 443
10 SASI_Rn02_00218577 predicted 996
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033259 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00288426 predicted 205
2 SASI_Mm02_00288427 predicted 263
3 SASI_Mm01_00060778 predicted 976
4 SASI_Mm02_00288428 predicted 508
5 SASI_Mm02_00288429 predicted 224
6 SASI_Mm02_00288430 predicted 309
7 SASI_Mm02_00288431 predicted 489
8 SASI_Mm02_00288432 predicted 211
9 SASI_Mm02_00288433 predicted 254
10 SASI_Mm02_00288434 predicted 377
11 SASI_Mm01_00060777 predicted 848
12 SASI_Mm01_00060779 predicted 836
13 SASI_Mm01_00060780 predicted 410
14 SASI_Mm01_00060781 predicted 498
15 SASI_Mm01_00060782 predicted 767
16 SASI_Mm01_00060783 predicted 606
17 SASI_Mm01_00060784 predicted 732
18 SASI_Mm01_00060785 predicted 565
19 SASI_Mm01_00060786 predicted 603
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_138357
MCU MISSION shRNA Bacterial Glycerol Stock
mitochondrial calcium uniporter
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000416434    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138357.1-540s21c1
Sequence:CCGGAGCAACGCTGAATGATGTAAACTCGAGTTTACATCATTCAGCGTTGCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000138929    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138357.1-183s1c1
Sequence:CCGGGATCGCTTCCTGGCAGAATTTCTCGAGAAATTCTGCCAGGAAGCGATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135430    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138357.1-844s1c1
Sequence:CCGGGCCATGGCAATGTATGCATATCTCGAGATATGCATACATTGCCATGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420533    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138357.1-1270s21c1
Sequence:CCGGTCAAAGGGCTTAGTGAATATTCTCGAGAATATTCACTAAGCCCTTTGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137529    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138357.1-570s1c1
Sequence:CCGGCCAGCAACTATACACCACACTCTCGAGAGTGTGGTGTATAGTTGCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000133984    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138357.1-972s1c1
Sequence:CCGGCAATCAACTCAAGGATGCAATCTCGAGATTGCATCCTTGAGTTGATTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435867    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138357.1-1247s21c1
Sequence:CCGGATCAGGCATTGTGGAATATAACTCGAGTTATATTCCACAATGCCTGATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000133861    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_138357.1-2439s1c1
Sequence:CCGGGCAAGGAGTTTCTTTCTCTTTCTCGAGAAAGAGAAAGAAACTCCTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_138357
MCU MISSION shRNA shRNA Plasmid DNA
mitochondrial calcium uniporter
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000416434    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138357.1-540s21c1
Sequence:CCGGAGCAACGCTGAATGATGTAAACTCGAGTTTACATCATTCAGCGTTGCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000138929    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138357.1-183s1c1
Sequence:CCGGGATCGCTTCCTGGCAGAATTTCTCGAGAAATTCTGCCAGGAAGCGATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000135430    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138357.1-844s1c1
Sequence:CCGGGCCATGGCAATGTATGCATATCTCGAGATATGCATACATTGCCATGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000420533    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138357.1-1270s21c1
Sequence:CCGGTCAAAGGGCTTAGTGAATATTCTCGAGAATATTCACTAAGCCCTTTGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000137529    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138357.1-570s1c1
Sequence:CCGGCCAGCAACTATACACCACACTCTCGAGAGTGTGGTGTATAGTTGCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000133984    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138357.1-972s1c1
Sequence:CCGGCAATCAACTCAAGGATGCAATCTCGAGATTGCATCCTTGAGTTGATTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000435867    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138357.1-1247s21c1
Sequence:CCGGATCAGGCATTGTGGAATATAACTCGAGTTATATTCCACAATGCCTGATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000133861    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_138357.1-2439s1c1
Sequence:CCGGGCAAGGAGTTTCTTTCTCTTTCTCGAGAAAGAGAAAGAAACTCCTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_138357
MCU MISSION shRNA Lentiviral Transduction Particles
mitochondrial calcium uniporter
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000416434    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138357.1-540s21c1
Sequence:CCGGAGCAACGCTGAATGATGTAAACTCGAGTTTACATCATTCAGCGTTGCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000138929    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138357.1-183s1c1
Sequence:CCGGGATCGCTTCCTGGCAGAATTTCTCGAGAAATTCTGCCAGGAAGCGATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135430    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138357.1-844s1c1
Sequence:CCGGGCCATGGCAATGTATGCATATCTCGAGATATGCATACATTGCCATGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420533    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138357.1-1270s21c1
Sequence:CCGGTCAAAGGGCTTAGTGAATATTCTCGAGAATATTCACTAAGCCCTTTGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137529    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138357.1-570s1c1
Sequence:CCGGCCAGCAACTATACACCACACTCTCGAGAGTGTGGTGTATAGTTGCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000133984    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138357.1-972s1c1
Sequence:CCGGCAATCAACTCAAGGATGCAATCTCGAGATTGCATCCTTGAGTTGATTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435867    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138357.1-1247s21c1
Sequence:CCGGATCAGGCATTGTGGAATATAACTCGAGTTATATTCCACAATGCCTGATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000133861    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_138357.1-2439s1c1
Sequence:CCGGGCAAGGAGTTTCTTTCTCTTTCTCGAGAAAGAGAAAGAAACTCCTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001033259
VALIDATED
MCU MISSION shRNA Bacterial Glycerol Stock
mitochondrial calcium uniporter
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000251263    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033259.3-1211s21c1
Sequence:CCGGTAGGGAATAAAGGGATCTTAACTCGAGTTAAGATCCCTTTATTCCCTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251262    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033259.3-994s21c1
Sequence:CCGGTCAGGCAGAAATGGATCTTAACTCGAGTTAAGATCCATTTCTGCCTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000267404    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033259.3-235s21c1
Sequence:CCGGTGATGACGTGACGGTGGTTTACTCGAGTAAACCACCGTCACGTCATCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000265169    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033259.3-844s21c1
Sequence:CCGGCATGGCCATGTATGCGTATTTCTCGAGAAATACGCATACATGGCCATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251261    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033259.3-1074s21c1
Sequence:CCGGGATCCGAGATGACCGTGAATCCTCGAGGATTCACGGTCATCTCGGATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001033259
VALIDATED
MCU MISSION shRNA shRNA Plasmid DNA
mitochondrial calcium uniporter
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000251263    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033259.3-1211s21c1
Sequence:CCGGTAGGGAATAAAGGGATCTTAACTCGAGTTAAGATCCCTTTATTCCCTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000251262    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033259.3-994s21c1
Sequence:CCGGTCAGGCAGAAATGGATCTTAACTCGAGTTAAGATCCATTTCTGCCTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000267404    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033259.3-235s21c1
Sequence:CCGGTGATGACGTGACGGTGGTTTACTCGAGTAAACCACCGTCACGTCATCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000265169    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033259.3-844s21c1
Sequence:CCGGCATGGCCATGTATGCGTATTTCTCGAGAAATACGCATACATGGCCATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000251261    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033259.3-1074s21c1
Sequence:CCGGGATCCGAGATGACCGTGAATCCTCGAGGATTCACGGTCATCTCGGATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001033259
VALIDATED
MCU MISSION shRNA Lentiviral Transduction Particles
mitochondrial calcium uniporter
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000251263    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033259.3-1211s21c1
Sequence:CCGGTAGGGAATAAAGGGATCTTAACTCGAGTTAAGATCCCTTTATTCCCTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251262    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033259.3-994s21c1
Sequence:CCGGTCAGGCAGAAATGGATCTTAACTCGAGTTAAGATCCATTTCTGCCTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000267404    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033259.3-235s21c1
Sequence:CCGGTGATGACGTGACGGTGGTTTACTCGAGTAAACCACCGTCACGTCATCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000265169    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033259.3-844s21c1
Sequence:CCGGCATGGCCATGTATGCGTATTTCTCGAGAAATACGCATACATGGCCATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251261    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033259.3-1074s21c1
Sequence:CCGGGATCCGAGATGACCGTGAATCCTCGAGGATTCACGGTCATCTCGGATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)