EMAIL THIS PAGE TO A FRIEND

MCUR1

mitochondrial calcium uniporter regulator 1

67 Gene Product Result for
Synonyms: C6orf79 CCDC90A
UniProtKB ID: Q96AQ8, Q96JS7, Q9H7F8
Gene ID:
Mouse(76137) mitochondrial calcium uniporter regulator 1
Rat(291034) mitochondrial calcium uniporter regulator 1
naked mole-rat(101718201) mitochondrial calcium uniporter regulator 1
domestic guinea pig(100727581) mitochondrial calcium uniporter regulator 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001031713 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001031713 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001031713 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001081059 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001081059 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001081059 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU199101 MISSION® esiRNA esiRNA targeting mouse Ccdc90a mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001031713 Rosetta Predictions human pricing
XM_001060245 Rosetta Predictions rat pricing
XM_214448 Rosetta Predictions rat pricing
NM_001081059 Rosetta Predictions mouse pricing
XM_127325 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001031713 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00037402 predicted 652
2 SASI_Hs01_00037406 predicted 602
3 SASI_Hs01_00037408 predicted 613
4 SASI_Hs02_00307733 predicted 687
5 SASI_Hs02_00307734 predicted 628
6 SASI_Hs02_00307735 predicted 773
7 SASI_Hs02_00307736 predicted 541
8 SASI_Hs02_00307737 predicted 543
9 SASI_Hs02_00307738 predicted 750
10 SASI_Hs02_00307739 predicted 641
11 SASI_Hs01_00037399 predicted 641
12 SASI_Hs01_00037400 predicted 716
13 SASI_Hs01_00037401 predicted 936
14 SASI_Hs01_00037403 predicted 725
15 SASI_Hs01_00037404 predicted 680
16 SASI_Hs01_00037405 predicted 878
17 SASI_Hs01_00037407 predicted 926
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001060245 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00295813 predicted 718
2 SASI_Rn02_00295814 predicted 713
3 SASI_Rn02_00295815 predicted 719
4 SASI_Rn02_00295816 predicted 847
5 SASI_Rn02_00295817 predicted 763
6 SASI_Rn02_00295818 predicted 871
7 SASI_Rn02_00295819 predicted 860
8 SASI_Rn02_00295820 predicted 622
9 SASI_Rn02_00295821 predicted 730
10 SASI_Rn02_00295822 predicted 957
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_214448 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00375295 predicted 252
2 SASI_Rn02_00375296 predicted 204
3 SASI_Rn02_00375297 predicted 194
4 SASI_Rn02_00375298 predicted 226
5 SASI_Rn02_00375299 predicted 1280
6 SASI_Rn02_00375300 predicted 724
7 SASI_Rn02_00375301 predicted 849
8 SASI_Rn02_00375302 predicted 756
9 SASI_Rn02_00375303 predicted 874
10 SASI_Rn02_00375304 predicted 857
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081059 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00294771 predicted 483
2 SASI_Mm02_00294772 predicted 776
3 SASI_Mm02_00294773 predicted 642
4 SASI_Mm02_00294774 predicted 779
5 SASI_Mm02_00294775 predicted 781
6 SASI_Mm02_00294776 predicted 489
7 SASI_Mm02_00294777 predicted 728
8 SASI_Mm02_00294778 predicted 900
9 SASI_Mm02_00294779 predicted 633
10 SASI_Mm02_00294780 predicted 657
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_127325 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00261717 predicted 1287
2 SASI_Mm01_00261718 predicted 621
3 SASI_Mm01_00261719 predicted 695
4 SASI_Mm01_00261720 predicted 841
5 SASI_Mm01_00261721 predicted 1032
6 SASI_Mm01_00261722 predicted 1078
7 SASI_Mm01_00261723 predicted 791
8 SASI_Mm01_00261724 predicted 784
9 SASI_Mm01_00261725 predicted 693
10 SASI_Mm01_00261726 predicted 725
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001031713
VALIDATED
MCUR1 MISSION shRNA Bacterial Glycerol Stock
mitochondrial calcium uniporter regulator 1
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000137294    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001031713.1-623s1c1
Sequence:CCGGGCTTACTGGAAGACAATGGGTCTCGAGACCCATTGTCTTCCAGTAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135901    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001031713.1-889s1c1
Sequence:CCGGGATGAAGTGATCAAAGTCCGACTCGAGTCGGACTTTGATCACTTCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135627    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_001031713.1-895s1c1
Sequence:CCGGGTGATCAAAGTCCGAACAGATCTCGAGATCTGTTCGGACTTTGATCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136263    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001031713.1-768s1c1
Sequence:CCGGGTCTCAGATTGCGAATGTGAACTCGAGTTCACATTCGCAATCTGAGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136480    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001031713.1-900s1c1
Sequence:CCGGCAAAGTCCGAACAGATACCAACTCGAGTTGGTATCTGTTCGGACTTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134711    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_001031713.1-984s1c1
Sequence:CCGGGCTGGAATTGAGAACAGAAATCTCGAGATTTCTGTTCTCAATTCCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134319    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_001031713.1-993s1c1
Sequence:CCGGGAGAACAGAAATAGTGGCATTCTCGAGAATGCCACTATTTCTGTTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135227    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001031713.1-982s1c1
Sequence:CCGGCTGCTGGAATTGAGAACAGAACTCGAGTTCTGTTCTCAATTCCAGCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435147    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001031713.2-878s21c1
Sequence:CCGGACTCGAACTACATCAGTTAAACTCGAGTTTAACTGATGTAGTTCGAGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419936    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001031713.2-1142s21c1
Sequence:CCGGATATTTAGCAGGGTCTATATTCTCGAGAATATAGACCCTGCTAAATATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418536    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001031713.2-728s21c1
Sequence:CCGGGGACATCGTCTACAAAGATATCTCGAGATATCTTTGTAGACGATGTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430425    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001031713.2-1117s21c1
Sequence:CCGGAGTCACACAAGCTTGATAATACTCGAGTATTATCAAGCTTGTGTGACTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432953    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001031713.2-787s21c1
Sequence:CCGGTAATGTCTCAGATTGCGAATGCTCGAGCATTCGCAATCTGAGACATTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001031713
VALIDATED
MCUR1 MISSION shRNA shRNA Plasmid DNA
mitochondrial calcium uniporter regulator 1
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000137294    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001031713.1-623s1c1
Sequence:CCGGGCTTACTGGAAGACAATGGGTCTCGAGACCCATTGTCTTCCAGTAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000135901    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001031713.1-889s1c1
Sequence:CCGGGATGAAGTGATCAAAGTCCGACTCGAGTCGGACTTTGATCACTTCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000135627    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_001031713.1-895s1c1
Sequence:CCGGGTGATCAAAGTCCGAACAGATCTCGAGATCTGTTCGGACTTTGATCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000136263    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001031713.1-768s1c1
Sequence:CCGGGTCTCAGATTGCGAATGTGAACTCGAGTTCACATTCGCAATCTGAGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000136480    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001031713.1-900s1c1
Sequence:CCGGCAAAGTCCGAACAGATACCAACTCGAGTTGGTATCTGTTCGGACTTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000134711    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_001031713.1-984s1c1
Sequence:CCGGGCTGGAATTGAGAACAGAAATCTCGAGATTTCTGTTCTCAATTCCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000134319    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_001031713.1-993s1c1
Sequence:CCGGGAGAACAGAAATAGTGGCATTCTCGAGAATGCCACTATTTCTGTTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000135227    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001031713.1-982s1c1
Sequence:CCGGCTGCTGGAATTGAGAACAGAACTCGAGTTCTGTTCTCAATTCCAGCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000435147    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001031713.2-878s21c1
Sequence:CCGGACTCGAACTACATCAGTTAAACTCGAGTTTAACTGATGTAGTTCGAGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000419936    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001031713.2-1142s21c1
Sequence:CCGGATATTTAGCAGGGTCTATATTCTCGAGAATATAGACCCTGCTAAATATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000418536    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001031713.2-728s21c1
Sequence:CCGGGGACATCGTCTACAAAGATATCTCGAGATATCTTTGTAGACGATGTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000430425    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001031713.2-1117s21c1
Sequence:CCGGAGTCACACAAGCTTGATAATACTCGAGTATTATCAAGCTTGTGTGACTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000432953    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001031713.2-787s21c1
Sequence:CCGGTAATGTCTCAGATTGCGAATGCTCGAGCATTCGCAATCTGAGACATTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001031713
VALIDATED
MCUR1 MISSION shRNA Lentiviral Transduction Particles
mitochondrial calcium uniporter regulator 1
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000137294    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001031713.1-623s1c1
Sequence:CCGGGCTTACTGGAAGACAATGGGTCTCGAGACCCATTGTCTTCCAGTAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135901    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001031713.1-889s1c1
Sequence:CCGGGATGAAGTGATCAAAGTCCGACTCGAGTCGGACTTTGATCACTTCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135627    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_001031713.1-895s1c1
Sequence:CCGGGTGATCAAAGTCCGAACAGATCTCGAGATCTGTTCGGACTTTGATCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136263    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001031713.1-768s1c1
Sequence:CCGGGTCTCAGATTGCGAATGTGAACTCGAGTTCACATTCGCAATCTGAGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136480    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001031713.1-900s1c1
Sequence:CCGGCAAAGTCCGAACAGATACCAACTCGAGTTGGTATCTGTTCGGACTTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134711    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_001031713.1-984s1c1
Sequence:CCGGGCTGGAATTGAGAACAGAAATCTCGAGATTTCTGTTCTCAATTCCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134319    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_001031713.1-993s1c1
Sequence:CCGGGAGAACAGAAATAGTGGCATTCTCGAGAATGCCACTATTTCTGTTCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135227    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001031713.1-982s1c1
Sequence:CCGGCTGCTGGAATTGAGAACAGAACTCGAGTTCTGTTCTCAATTCCAGCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435147    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001031713.2-878s21c1
Sequence:CCGGACTCGAACTACATCAGTTAAACTCGAGTTTAACTGATGTAGTTCGAGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419936    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001031713.2-1142s21c1
Sequence:CCGGATATTTAGCAGGGTCTATATTCTCGAGAATATAGACCCTGCTAAATATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418536    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001031713.2-728s21c1
Sequence:CCGGGGACATCGTCTACAAAGATATCTCGAGATATCTTTGTAGACGATGTCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430425    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001031713.2-1117s21c1
Sequence:CCGGAGTCACACAAGCTTGATAATACTCGAGTATTATCAAGCTTGTGTGACTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432953    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001031713.2-787s21c1
Sequence:CCGGTAATGTCTCAGATTGCGAATGCTCGAGCATTCGCAATCTGAGACATTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001081059
MCUR1 MISSION shRNA Bacterial Glycerol Stock
mitochondrial calcium uniporter regulator 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000252852    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081059.2-622s21c1
Sequence:CCGGTCGCTCTCCAGCAGGTATTATCTCGAGATAATACCTGCTGGAGAGCGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252854    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081059.2-499s21c1
Sequence:CCGGTACTTGAAGCAAATGGGTTTACTCGAGTAAACCCATTTGCTTCAAGTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252855    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081059.2-973s21c1
Sequence:CCGGACAAGCTTGATACAATCAAATCTCGAGATTTGATTGTATCAAGCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252853    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081059.2-777s21c1
Sequence:CCGGGTCCGGACAGATACCAAATTACTCGAGTAATTTGGTATCTGTCCGGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252851    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081059.2-728s21c1
Sequence:CCGGACTTGAACTGCACCAGTTAAACTCGAGTTTAACTGGTGCAGTTCAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001081059
MCUR1 MISSION shRNA shRNA Plasmid DNA
mitochondrial calcium uniporter regulator 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000252852    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081059.2-622s21c1
Sequence:CCGGTCGCTCTCCAGCAGGTATTATCTCGAGATAATACCTGCTGGAGAGCGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000252854    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081059.2-499s21c1
Sequence:CCGGTACTTGAAGCAAATGGGTTTACTCGAGTAAACCCATTTGCTTCAAGTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000252855    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081059.2-973s21c1
Sequence:CCGGACAAGCTTGATACAATCAAATCTCGAGATTTGATTGTATCAAGCTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000252853    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081059.2-777s21c1
Sequence:CCGGGTCCGGACAGATACCAAATTACTCGAGTAATTTGGTATCTGTCCGGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000252851    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081059.2-728s21c1
Sequence:CCGGACTTGAACTGCACCAGTTAAACTCGAGTTTAACTGGTGCAGTTCAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001081059
MCUR1 MISSION shRNA Lentiviral Transduction Particles
mitochondrial calcium uniporter regulator 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000252852    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081059.2-622s21c1
Sequence:CCGGTCGCTCTCCAGCAGGTATTATCTCGAGATAATACCTGCTGGAGAGCGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252854    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081059.2-499s21c1
Sequence:CCGGTACTTGAAGCAAATGGGTTTACTCGAGTAAACCCATTTGCTTCAAGTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252855    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081059.2-973s21c1
Sequence:CCGGACAAGCTTGATACAATCAAATCTCGAGATTTGATTGTATCAAGCTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252853    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081059.2-777s21c1
Sequence:CCGGGTCCGGACAGATACCAAATTACTCGAGTAATTTGGTATCTGTCCGGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252851    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081059.2-728s21c1
Sequence:CCGGACTTGAACTGCACCAGTTAAACTCGAGTTTAACTGGTGCAGTTCAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)