EMAIL THIS PAGE TO A FRIEND

MDC1

mediator of DNA-damage checkpoint 1

74 Gene Product Result for
Synonyms: NFBD1
Gene ID:
Human(9656) Summary: The protein encoded by this gene contains an N-terminal forkhead domain, two BRCA1 C-terminal (BRCT) motifs and a central domain with 13 repetitions of an approximately 41-amino acid sequence. The encoded protein is required to activate the intra-S phase and G2/M phase cell cycle checkpoints in response to DNA damage. This nuclear protein interacts with phosphorylated histone H2AX near sites of DNA double-strand breaks through its BRCT motifs, and facilitates recruitment of the ATM kinase and meiotic recombination 11 protein complex to DNA damage foci. [provided by RefSeq, Jul 2008]
Mouse(240087) mediator of DNA damage checkpoint 1
Rat(309595) mediator of DNA damage checkpoint 1
chicken(101664732) mediator of DNA-damage checkpoint 1
chicken(101751335) mediator of DNA-damage checkpoint 1
cow(511168) mediator of DNA-damage checkpoint 1
Horse(100055473) mediator of DNA-damage checkpoint 1
domestic cat(101095415) mediator of DNA-damage checkpoint 1
dog(474829) mediator of DNA-damage checkpoint 1
sheep(101107143) mediator of DNA-damage checkpoint 1
domestic guinea pig(100721744) mediator of DNA-damage checkpoint 1
naked mole-rat(101702518) mediator of DNA-damage checkpoint 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001010833 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001010833 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001010833 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-XM_376479 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_376479 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_376479 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014641 Rosetta Predictions human pricing
XM_001072849 Rosetta Predictions rat pricing
XM_227971 Rosetta Predictions rat pricing
NM_001010833 Rosetta Predictions mouse pricing
XM_992110 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014641 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00088939 predicted 1672
2 SASI_Hs01_00088940 predicted 6578
3 SASI_Hs01_00088941 predicted 1481
4 SASI_Hs01_00088942 predicted 4869
5 SASI_Hs01_00088943 predicted 6372
6 SASI_Hs01_00088944 predicted 2648
7 SASI_Hs02_00345953 predicted 491
8 SASI_Hs02_00345954 predicted 454
9 SASI_Hs01_00088947 predicted 6362
10 SASI_Hs01_00088948 predicted 2864
11 SASI_Hs01_00088945 predicted 6110
12 SASI_Hs01_00088946 predicted 5473
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001072849 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00340660 predicted 403
2 SASI_Rn02_00340661 predicted 924
3 SASI_Rn02_00340662 predicted 3044
4 SASI_Rn02_00340663 predicted 264
5 SASI_Rn02_00340664 predicted 2481
6 SASI_Rn02_00340665 predicted 2081
7 SASI_Rn02_00340666 predicted 3080
8 SASI_Rn02_00340667 predicted 3317
9 SASI_Rn02_00340668 predicted 3399
10 SASI_Rn02_00340669 predicted 1114
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_227971 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00384811 predicted 408
2 SASI_Rn02_00384812 predicted 933
3 SASI_Rn02_00384813 predicted 3061
4 SASI_Rn02_00384814 predicted 266
5 SASI_Rn02_00384815 predicted 2478
6 SASI_Rn02_00384816 predicted 2081
7 SASI_Rn02_00384817 predicted 3097
8 SASI_Rn02_00384818 predicted 3333
9 SASI_Rn02_00384819 predicted 3407
10 SASI_Rn02_00384820 predicted 1122
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001010833 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00286895 predicted 1632
2 SASI_Mm02_00286896 predicted 1625
3 SASI_Mm02_00286897 predicted 270
4 SASI_Mm02_00286898 predicted 1814
5 SASI_Mm02_00286899 predicted 2070
6 SASI_Mm02_00286900 predicted 3798
7 SASI_Mm02_00286901 predicted 4434
8 SASI_Mm02_00286902 predicted 3325
9 SASI_Mm02_00286903 predicted 4249
10 SASI_Mm02_00286904 predicted 1941
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_992110 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00284710 predicted 2436
2 SASI_Mm01_00284711 predicted 2631
3 SASI_Mm01_00284712 predicted 1477
4 SASI_Mm01_00284713 predicted 2692
5 SASI_Mm01_00284714 predicted 2429
6 SASI_Mm01_00284715 predicted 2481
7 SASI_Mm01_00284716 predicted 2705
8 SASI_Mm01_00284717 predicted 1928
9 SASI_Mm01_00284718 predicted 3644
10 SASI_Mm01_00284719 predicted 4288
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001010833
VALIDATED
MDC1 MISSION shRNA Bacterial Glycerol Stock
mediator of DNA-damage checkpoint 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000239478    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001010833.2-464s21c1
Sequence:CCGGGAGCCTCAATGGCACTCAAATCTCGAGATTTGAGTGCCATTGAGGCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000239479    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001010833.2-5469s21c1
Sequence:CCGGGGGCTAGCCAGAGGTACATAACTCGAGTTATGTACCTCTGGCTAGCCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000239477    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001010833.2-607s21c1
Sequence:CCGGCTCGGAGTCTTCTAACTATAGCTCGAGCTATAGTTAGAAGACTCCGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000239476    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001010833.2-5124s21c1
Sequence:CCGGAGCATGCCTCACTCCTATAAGCTCGAGCTTATAGGAGTGAGGCATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000239480    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001010833.2-1192s21c1
Sequence:CCGGTGCTACTTGCAGTTGGTATAGCTCGAGCTATACCAACTGCAAGTAGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001010833
VALIDATED
MDC1 MISSION shRNA shRNA Plasmid DNA
mediator of DNA-damage checkpoint 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000239478    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001010833.2-464s21c1
Sequence:CCGGGAGCCTCAATGGCACTCAAATCTCGAGATTTGAGTGCCATTGAGGCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000239479    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001010833.2-5469s21c1
Sequence:CCGGGGGCTAGCCAGAGGTACATAACTCGAGTTATGTACCTCTGGCTAGCCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000239477    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001010833.2-607s21c1
Sequence:CCGGCTCGGAGTCTTCTAACTATAGCTCGAGCTATAGTTAGAAGACTCCGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000239476    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001010833.2-5124s21c1
Sequence:CCGGAGCATGCCTCACTCCTATAAGCTCGAGCTTATAGGAGTGAGGCATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000239480    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001010833.2-1192s21c1
Sequence:CCGGTGCTACTTGCAGTTGGTATAGCTCGAGCTATACCAACTGCAAGTAGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001010833
VALIDATED
MDC1 MISSION shRNA Lentiviral Transduction Particles
mediator of DNA-damage checkpoint 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000239478    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001010833.2-464s21c1
Sequence:CCGGGAGCCTCAATGGCACTCAAATCTCGAGATTTGAGTGCCATTGAGGCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000239479    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001010833.2-5469s21c1
Sequence:CCGGGGGCTAGCCAGAGGTACATAACTCGAGTTATGTACCTCTGGCTAGCCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000239477    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001010833.2-607s21c1
Sequence:CCGGCTCGGAGTCTTCTAACTATAGCTCGAGCTATAGTTAGAAGACTCCGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000239476    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001010833.2-5124s21c1
Sequence:CCGGAGCATGCCTCACTCCTATAAGCTCGAGCTTATAGGAGTGAGGCATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000239480    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001010833.2-1192s21c1
Sequence:CCGGTGCTACTTGCAGTTGGTATAGCTCGAGCTATACCAACTGCAAGTAGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_376479
MDC1 MISSION shRNA Bacterial Glycerol Stock
mediator of DNA-damage checkpoint 1
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000018850    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_376479.1-4734s1c1
Sequence:CCGGCCCTGAATCAACTGTCCCTATCTCGAGATAGGGACAGTTGATTCAGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018854    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_376479.1-2414s1c1
Sequence:CCGGCCTCAGTAGTTGCAGATGTAACTCGAGTTACATCTGCAACTACTGAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018853    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_376479.1-3862s1c1
Sequence:CCGGCCTTCTATCAAGCCAACCGTTCTCGAGAACGGTTGGCTTGATAGAAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018851    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_376479.1-6295s1c1
Sequence:CCGGCGGACCAAACTTAACCAAGAACTCGAGTTCTTGGTTAAGTTTGGTCCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018852    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_376479.1-1918s1c1
Sequence:CCGGCCTGCTATATGGAACAGAGATCTCGAGATCTCTGTTCCATATAGCAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_376479
MDC1 MISSION shRNA shRNA Plasmid DNA
mediator of DNA-damage checkpoint 1
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000018850    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_376479.1-4734s1c1
Sequence:CCGGCCCTGAATCAACTGTCCCTATCTCGAGATAGGGACAGTTGATTCAGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000018854    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_376479.1-2414s1c1
Sequence:CCGGCCTCAGTAGTTGCAGATGTAACTCGAGTTACATCTGCAACTACTGAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000018853    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_376479.1-3862s1c1
Sequence:CCGGCCTTCTATCAAGCCAACCGTTCTCGAGAACGGTTGGCTTGATAGAAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000018851    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_376479.1-6295s1c1
Sequence:CCGGCGGACCAAACTTAACCAAGAACTCGAGTTCTTGGTTAAGTTTGGTCCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000018852    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_376479.1-1918s1c1
Sequence:CCGGCCTGCTATATGGAACAGAGATCTCGAGATCTCTGTTCCATATAGCAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_376479
MDC1 MISSION shRNA Lentiviral Transduction Particles
mediator of DNA-damage checkpoint 1
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000018850    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_376479.1-4734s1c1
Sequence:CCGGCCCTGAATCAACTGTCCCTATCTCGAGATAGGGACAGTTGATTCAGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018854    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_376479.1-2414s1c1
Sequence:CCGGCCTCAGTAGTTGCAGATGTAACTCGAGTTACATCTGCAACTACTGAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018853    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_376479.1-3862s1c1
Sequence:CCGGCCTTCTATCAAGCCAACCGTTCTCGAGAACGGTTGGCTTGATAGAAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018851    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_376479.1-6295s1c1
Sequence:CCGGCGGACCAAACTTAACCAAGAACTCGAGTTCTTGGTTAAGTTTGGTCCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018852    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_376479.1-1918s1c1
Sequence:CCGGCCTGCTATATGGAACAGAGATCTCGAGATCTCTGTTCCATATAGCAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)