EMAIL THIS PAGE TO A FRIEND

MDFI

MyoD family inhibitor

73 Gene Product Result for
Synonyms: I-MF I-mfa
UniProtKB ID: Q99750
Gene ID:
Human(4188) Summary: This protein is a transcription factor that negatively regulates other myogenic family proteins. Studies of the mouse homolog, I-mf, show that it interferes with myogenic factor function by masking nuclear localization signals and preventing DNA binding. Knockout mouse studies show defects in the formation of vertebrae and ribs that also involve cartilage formation in these structures. [provided by RefSeq, Jul 2008]
Mouse(17240) MyoD family inhibitor
Rat(501097) MyoD family inhibitor
chicken(419921) MyoD family inhibitor
cow(286808) MyoD family inhibitor
domestic cat(101091368) MyoD family inhibitor
dog(609042) MyoD family inhibitor
naked mole-rat(101714269) MyoD family inhibitor
Domestic Rabbit(100328713) MyoD family inhibitor
domestic guinea pig(100716838) MyoD family inhibitor
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005586 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005586 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005586 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010783 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010783 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010783 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005586 Rosetta Predictions human pricing
NM_001109301 Rosetta Predictions rat pricing
NM_001109973 Rosetta Predictions mouse pricing
NM_010783 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005586 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00223684 predicted 328
2 SASI_Hs01_00223689 predicted 720
3 SASI_Hs02_00339872 predicted 722
4 SASI_Hs02_00339873 predicted 451
5 SASI_Hs02_00339874 predicted 899
6 SASI_Hs02_00339875 predicted 309
7 SASI_Hs02_00339876 predicted 454
8 SASI_Hs02_00339877 predicted 689
9 SASI_Hs02_00339878 predicted 452
10 SASI_Hs02_00339879 predicted 1432
11 SASI_Hs01_00223683 predicted 1131
12 SASI_Hs01_00223685 predicted 1134
13 SASI_Hs01_00223686 predicted 1130
14 SASI_Hs01_00223687 predicted 1154
15 SASI_Hs01_00223688 predicted 402
16 SASI_Hs01_00223690 predicted 968
17 SASI_Hs01_00223691 predicted 1106
18 SASI_Hs01_00223692 predicted 1140
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109301 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00247074 predicted 668
2 SASI_Rn02_00247075 predicted 540
3 SASI_Rn02_00247076 predicted 688
4 SASI_Rn02_00247077 predicted 549
5 SASI_Rn02_00247078 predicted 1171
6 SASI_Rn02_00247079 predicted 399
7 SASI_Rn02_00247080 predicted 546
8 SASI_Rn02_00247081 predicted 1164
9 SASI_Rn02_00247082 predicted 985
10 SASI_Rn02_00247083 predicted 1176
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109973 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00304474 predicted 756
2 SASI_Mm02_00304475 predicted 1335
3 SASI_Mm02_00304476 predicted 1250
4 SASI_Mm02_00304477 predicted 1328
5 SASI_Mm02_00304478 predicted 885
6 SASI_Mm02_00304479 predicted 909
7 SASI_Mm02_00304480 predicted 594
8 SASI_Mm02_00304481 predicted 1394
9 SASI_Mm02_00304482 predicted 1156
10 SASI_Mm02_00304483 predicted 1149
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010783 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00103033 predicted 392
2 SASI_Mm01_00103035 predicted 971
3 SASI_Mm01_00103036 predicted 888
4 SASI_Mm01_00103037 predicted 966
5 SASI_Mm02_00319347 predicted 514
6 SASI_Mm02_00319348 predicted 545
7 SASI_Mm01_00103039 predicted 231
8 SASI_Mm02_00319349 predicted 1032
9 SASI_Mm02_00319350 predicted 786
10 SASI_Mm02_00319351 predicted 779
11 SASI_Mm01_00103032 predicted 341
12 SASI_Mm01_00103034 predicted 338
13 SASI_Mm01_00103038 predicted 622
14 SASI_Mm01_00103040 predicted 709
15 SASI_Mm01_00103041 predicted 592
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005586
MDFI MISSION shRNA Bacterial Glycerol Stock
MyoD family inhibitor
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000015503    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005586.2-1114s1c1
Sequence:CCGGCCTGAACTCTTTACTGGGTTACTCGAGTAACCCAGTAAAGAGTTCAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015504    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005586.2-563s1c1
Sequence:CCGGCCAGGGCAGCAAGAAGAGTAACTCGAGTTACTCTTCTTGCTGCCCTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015507    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005586.2-335s1c1
Sequence:CCGGCCAAGGCAATGGCCCTGGCATCTCGAGATGCCAGGGCCATTGCCTTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015506    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005586.2-253s1c1
Sequence:CCGGTGGAGGTAGTAACAGGATCCACTCGAGTGGATCCTGTTACTACCTCCATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015505    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005586.2-671s1c1
Sequence:CCGGCGAGTTCCTGACGCTGTGCAACTCGAGTTGCACAGCGTCAGGAACTCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432424    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005586.3-595s21c1
Sequence:CCGGTTGCAGACACACCCATCTCTCCTCGAGGAGAGATGGGTGTGTCTGCAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421957    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005586.3-451s21c1
Sequence:CCGGACAGAAGCTGTGACATGCCAGCTCGAGCTGGCATGTCACAGCTTCTGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425601    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005586.3-690s21c1
Sequence:CCGGAGACTGCTGTGTCCACTGCATCTCGAGATGCAGTGGACACAGCAGTCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427897    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005586.3-500s21c1
Sequence:CCGGCACTTCTGCCGAATGACTCTGCTCGAGCAGAGTCATTCGGCAGAAGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412434    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005586.3-303s21c1
Sequence:CCGGTCCTGGGCTGGAGGTAGTAACCTCGAGGTTACTACCTCCAGCCCAGGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417703    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005586.3-907s21c1
Sequence:CCGGGAGATCTGCATGGAGTGCTGTCTCGAGACAGCACTCCATGCAGATCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427893    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005586.3-714s21c1
Sequence:CCGGGTCCTGCCTGTTCTGCGAGTTCTCGAGAACTCGCAGAACAGGCAGGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005586
MDFI MISSION shRNA shRNA Plasmid DNA
MyoD family inhibitor
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000015503    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005586.2-1114s1c1
Sequence:CCGGCCTGAACTCTTTACTGGGTTACTCGAGTAACCCAGTAAAGAGTTCAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000015504    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005586.2-563s1c1
Sequence:CCGGCCAGGGCAGCAAGAAGAGTAACTCGAGTTACTCTTCTTGCTGCCCTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000015507    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005586.2-335s1c1
Sequence:CCGGCCAAGGCAATGGCCCTGGCATCTCGAGATGCCAGGGCCATTGCCTTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000015506    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005586.2-253s1c1
Sequence:CCGGTGGAGGTAGTAACAGGATCCACTCGAGTGGATCCTGTTACTACCTCCATTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000015505    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005586.2-671s1c1
Sequence:CCGGCGAGTTCCTGACGCTGTGCAACTCGAGTTGCACAGCGTCAGGAACTCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000432424    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005586.3-595s21c1
Sequence:CCGGTTGCAGACACACCCATCTCTCCTCGAGGAGAGATGGGTGTGTCTGCAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000421957    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005586.3-451s21c1
Sequence:CCGGACAGAAGCTGTGACATGCCAGCTCGAGCTGGCATGTCACAGCTTCTGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000425601    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005586.3-690s21c1
Sequence:CCGGAGACTGCTGTGTCCACTGCATCTCGAGATGCAGTGGACACAGCAGTCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000427897    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005586.3-500s21c1
Sequence:CCGGCACTTCTGCCGAATGACTCTGCTCGAGCAGAGTCATTCGGCAGAAGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000412434    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005586.3-303s21c1
Sequence:CCGGTCCTGGGCTGGAGGTAGTAACCTCGAGGTTACTACCTCCAGCCCAGGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000417703    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005586.3-907s21c1
Sequence:CCGGGAGATCTGCATGGAGTGCTGTCTCGAGACAGCACTCCATGCAGATCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000427893    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005586.3-714s21c1
Sequence:CCGGGTCCTGCCTGTTCTGCGAGTTCTCGAGAACTCGCAGAACAGGCAGGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005586
MDFI MISSION shRNA Lentiviral Transduction Particles
MyoD family inhibitor
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000015503    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005586.2-1114s1c1
Sequence:CCGGCCTGAACTCTTTACTGGGTTACTCGAGTAACCCAGTAAAGAGTTCAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015504    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005586.2-563s1c1
Sequence:CCGGCCAGGGCAGCAAGAAGAGTAACTCGAGTTACTCTTCTTGCTGCCCTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015507    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005586.2-335s1c1
Sequence:CCGGCCAAGGCAATGGCCCTGGCATCTCGAGATGCCAGGGCCATTGCCTTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015506    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005586.2-253s1c1
Sequence:CCGGTGGAGGTAGTAACAGGATCCACTCGAGTGGATCCTGTTACTACCTCCATTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015505    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005586.2-671s1c1
Sequence:CCGGCGAGTTCCTGACGCTGTGCAACTCGAGTTGCACAGCGTCAGGAACTCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432424    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005586.3-595s21c1
Sequence:CCGGTTGCAGACACACCCATCTCTCCTCGAGGAGAGATGGGTGTGTCTGCAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421957    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005586.3-451s21c1
Sequence:CCGGACAGAAGCTGTGACATGCCAGCTCGAGCTGGCATGTCACAGCTTCTGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425601    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005586.3-690s21c1
Sequence:CCGGAGACTGCTGTGTCCACTGCATCTCGAGATGCAGTGGACACAGCAGTCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427897    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005586.3-500s21c1
Sequence:CCGGCACTTCTGCCGAATGACTCTGCTCGAGCAGAGTCATTCGGCAGAAGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412434    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005586.3-303s21c1
Sequence:CCGGTCCTGGGCTGGAGGTAGTAACCTCGAGGTTACTACCTCCAGCCCAGGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417703    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005586.3-907s21c1
Sequence:CCGGGAGATCTGCATGGAGTGCTGTCTCGAGACAGCACTCCATGCAGATCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427893    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005586.3-714s21c1
Sequence:CCGGGTCCTGCCTGTTCTGCGAGTTCTCGAGAACTCGCAGAACAGGCAGGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010783
MDFI MISSION shRNA Bacterial Glycerol Stock
MyoD family inhibitor
Mouse
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000055303    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010783.1-621s1c1
Sequence:CCGGGCCACCGAACAGGTCTGCTTTCTCGAGAAAGCAGACCTGTTCGGTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055305    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010783.1-337s1c1
Sequence:CCGGCCTGTAGAGGCATCTTCTGAACTCGAGTTCAGAAGATGCCTCTACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055307    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010783.1-671s1c1
Sequence:CCGGTGACCAGGAACACGGCATCTACTCGAGTAGATGCCGTGTTCCTGGTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055306    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010783.1-592s1c1
Sequence:CCGGCACCGGAAGTTGCAGACGCATCTCGAGATGCGTCTGCAACTTCCGGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055304    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010783.1-424s1c1
Sequence:CCGGCTGAACAGCATTGACCTCGATCTCGAGATCGAGGTCAATGCTGTTCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174206    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010783.1-621s1c2
Sequence:CCGGGCCACCGAACAGGTCTGCTTTCTCGAGAAAGCAGACCTGTTCGGTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010783
MDFI MISSION shRNA shRNA Plasmid DNA
MyoD family inhibitor
Mouse
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000055303    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010783.1-621s1c1
Sequence:CCGGGCCACCGAACAGGTCTGCTTTCTCGAGAAAGCAGACCTGTTCGGTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000055305    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010783.1-337s1c1
Sequence:CCGGCCTGTAGAGGCATCTTCTGAACTCGAGTTCAGAAGATGCCTCTACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000055307    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010783.1-671s1c1
Sequence:CCGGTGACCAGGAACACGGCATCTACTCGAGTAGATGCCGTGTTCCTGGTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000055306    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010783.1-592s1c1
Sequence:CCGGCACCGGAAGTTGCAGACGCATCTCGAGATGCGTCTGCAACTTCCGGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000055304    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010783.1-424s1c1
Sequence:CCGGCTGAACAGCATTGACCTCGATCTCGAGATCGAGGTCAATGCTGTTCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000174206    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010783.1-621s1c2
Sequence:CCGGGCCACCGAACAGGTCTGCTTTCTCGAGAAAGCAGACCTGTTCGGTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010783
MDFI MISSION shRNA Lentiviral Transduction Particles
MyoD family inhibitor
Mouse
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000055303    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010783.1-621s1c1
Sequence:CCGGGCCACCGAACAGGTCTGCTTTCTCGAGAAAGCAGACCTGTTCGGTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055305    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010783.1-337s1c1
Sequence:CCGGCCTGTAGAGGCATCTTCTGAACTCGAGTTCAGAAGATGCCTCTACAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055307    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010783.1-671s1c1
Sequence:CCGGTGACCAGGAACACGGCATCTACTCGAGTAGATGCCGTGTTCCTGGTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055306    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010783.1-592s1c1
Sequence:CCGGCACCGGAAGTTGCAGACGCATCTCGAGATGCGTCTGCAACTTCCGGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055304    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010783.1-424s1c1
Sequence:CCGGCTGAACAGCATTGACCTCGATCTCGAGATCGAGGTCAATGCTGTTCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174206    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010783.1-621s1c2
Sequence:CCGGGCCACCGAACAGGTCTGCTTTCTCGAGAAAGCAGACCTGTTCGGTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)