EMAIL THIS PAGE TO A FRIEND

MDFIC

MyoD family inhibitor domain containing

99 Gene Product Result for
Synonyms: HIC
UniProtKB ID: Q9P1T7, Q9P1T6
Gene ID:
Human(29969) Summary: This gene product is a member of a family of proteins characterized by a specific cysteine-rich C-terminal domain, which is involved in transcriptional regulation of viral genome expression. Alternative translation initiation from an upstream non-AUG (GUG), and an in-frame, downstream AUG codon, results in the production of two isoforms, p40 and p32, respectively, which have different subcellular localization; p32 is mainly found in the cytoplasm, whereas p40 is targeted to the nucleolus. Both isoforms have transcriptional regulatory activity that is attributable to the cysteine-rich C-terminal domain. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2009]
Mouse(16543) MyoD family inhibitor domain containing
Rat(362325) MyoD family inhibitor domain containing
domestic guinea pig(100730941) MyoD family inhibitor domain containing
Domestic Rabbit(100328794) MyoD family inhibitor domain containing
naked mole-rat(101698954) MyoD family inhibitor domain containing
sheep(101108043) MyoD family inhibitor domain containing
chicken(417774) MyoD family inhibitor domain containing
domestic cat(101087650) MyoD family inhibitor domain containing
cow(520530) MyoD family inhibitor domain containing
dog(612042) MyoD family inhibitor domain containing
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_175088 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_175088 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_175088 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_199072 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_199072 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_199072 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_199072 Rosetta Predictions human pricing
NM_001105668 Rosetta Predictions rat pricing
NM_175088 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_199072 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00010721 predicted 935
2 SASI_Hs01_00010722 predicted 1129
3 SASI_Hs01_00010723 predicted 1028
4 SASI_Hs01_00010724 predicted 1416
5 SASI_Hs01_00010725 predicted 1291
6 SASI_Hs01_00010726 predicted 1022
7 SASI_Hs01_00010727 predicted 1411
8 SASI_Hs01_00010728 predicted 1392
9 SASI_Hs01_00010729 predicted 1255
10 SASI_Hs01_00010730 predicted 927
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001105668 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00211746 predicted 645
2 SASI_Rn02_00211747 predicted 1126
3 SASI_Rn02_00211748 predicted 488
4 SASI_Rn02_00211749 predicted 701
5 SASI_Rn02_00211750 predicted 1192
6 SASI_Rn02_00211751 predicted 790
7 SASI_Rn02_00211752 predicted 778
8 SASI_Rn02_00211753 predicted 1047
9 SASI_Rn02_00211754 predicted 1017
10 SASI_Rn02_00211755 predicted 849
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175088 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00345662 predicted 652
2 SASI_Mm01_00150010 predicted 929
3 SASI_Mm01_00150011 predicted 820
4 SASI_Mm01_00150012 predicted 1155
5 SASI_Mm01_00150013 predicted 764
6 SASI_Mm01_00150014 predicted 718
7 SASI_Mm01_00150015 predicted 1002
8 SASI_Mm01_00150016 predicted 1193
9 SASI_Mm01_00150018 predicted 704
10 SASI_Mm01_00150019 predicted 1211
11 SASI_Mm01_00150017 predicted 646
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175088
VALIDATED
MDFIC MISSION shRNA Bacterial Glycerol Stock
MyoD family inhibitor domain containing
Mouse
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000362432    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175088.5-926s21c1
Sequence:CCGGTCCTGACCCTCTGCAACATTGCTCGAGCAATGTTGCAGAGGGTCAGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000237995    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175088.5-1074s21c1
Sequence:CCGGATCGTCAGACTGTCTAGAAATCTCGAGATTTCTAGACAGTCTGACGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000237998    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175088.5-2377s21c1
Sequence:CCGGTGCCAAGTGACAGGTTATAAACTCGAGTTTATAACCTGTCACTTGGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000237997    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175088.5-657s21c1
Sequence:CCGGGGAGGAAACAGGCAAGATAAACTCGAGTTTATCTTGCCTGTTTCCTCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000237996    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175088.5-1038s21c1
Sequence:CCGGTGACATGGACTGCGGCATCATCTCGAGATGATGCCGCAGTCCATGTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000237994    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175088.5-551s21c1
Sequence:CCGGTGATGCGGGACCAGTCCATTTCTCGAGAAATGGACTGGTCCCGCATCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000362509    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175088.5-1513s21c1
Sequence:CCGGGTTTATCTATTGGAGGTTAAACTCGAGTTTAACCTCCAATAGATAAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000362431    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175088.5-1292s21c1
Sequence:CCGGGCCGGATGTATGTGGTTTAATCTCGAGATTAAACCACATACATCCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000095981    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175088.2-420s1c1
Sequence:CCGGCGAAGCATGTAATGAGGACAACTCGAGTTGTCCTCATTACATGCTTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000095980    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175088.2-680s1c1
Sequence:CCGGCCGTGGAGAATCACAAGATATCTCGAGATATCTTGTGATTCTCCACGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000095982    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175088.2-760s1c1
Sequence:CCGGGACATCAGTAAGAAGAGTAAACTCGAGTTTACTCTTCTTACTGATGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000095979    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175088.2-1231s1c1
Sequence:CCGGCGCCGGATGTATGTGGTTTAACTCGAGTTAAACCACATACATCCGGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000095983    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175088.2-877s1c1
Sequence:CCGGTGCAACATTGTCCTGGGACAACTCGAGTTGTCCCAGGACAATGTTGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175088
VALIDATED
MDFIC MISSION shRNA shRNA Plasmid DNA
MyoD family inhibitor domain containing
Mouse
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000362432    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175088.5-926s21c1
Sequence:CCGGTCCTGACCCTCTGCAACATTGCTCGAGCAATGTTGCAGAGGGTCAGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000237995    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175088.5-1074s21c1
Sequence:CCGGATCGTCAGACTGTCTAGAAATCTCGAGATTTCTAGACAGTCTGACGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000237998    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175088.5-2377s21c1
Sequence:CCGGTGCCAAGTGACAGGTTATAAACTCGAGTTTATAACCTGTCACTTGGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000237997    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175088.5-657s21c1
Sequence:CCGGGGAGGAAACAGGCAAGATAAACTCGAGTTTATCTTGCCTGTTTCCTCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000237996    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175088.5-1038s21c1
Sequence:CCGGTGACATGGACTGCGGCATCATCTCGAGATGATGCCGCAGTCCATGTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000237994    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175088.5-551s21c1
Sequence:CCGGTGATGCGGGACCAGTCCATTTCTCGAGAAATGGACTGGTCCCGCATCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000362509    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175088.5-1513s21c1
Sequence:CCGGGTTTATCTATTGGAGGTTAAACTCGAGTTTAACCTCCAATAGATAAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000362431    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175088.5-1292s21c1
Sequence:CCGGGCCGGATGTATGTGGTTTAATCTCGAGATTAAACCACATACATCCGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000095981    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175088.2-420s1c1
Sequence:CCGGCGAAGCATGTAATGAGGACAACTCGAGTTGTCCTCATTACATGCTTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000095980    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175088.2-680s1c1
Sequence:CCGGCCGTGGAGAATCACAAGATATCTCGAGATATCTTGTGATTCTCCACGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000095982    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175088.2-760s1c1
Sequence:CCGGGACATCAGTAAGAAGAGTAAACTCGAGTTTACTCTTCTTACTGATGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000095979    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175088.2-1231s1c1
Sequence:CCGGCGCCGGATGTATGTGGTTTAACTCGAGTTAAACCACATACATCCGGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000095983    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175088.2-877s1c1
Sequence:CCGGTGCAACATTGTCCTGGGACAACTCGAGTTGTCCCAGGACAATGTTGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175088
VALIDATED
MDFIC MISSION shRNA Lentiviral Transduction Particles
MyoD family inhibitor domain containing
Mouse
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000362432    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175088.5-926s21c1
Sequence:CCGGTCCTGACCCTCTGCAACATTGCTCGAGCAATGTTGCAGAGGGTCAGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000237995    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175088.5-1074s21c1
Sequence:CCGGATCGTCAGACTGTCTAGAAATCTCGAGATTTCTAGACAGTCTGACGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000237998    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175088.5-2377s21c1
Sequence:CCGGTGCCAAGTGACAGGTTATAAACTCGAGTTTATAACCTGTCACTTGGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000237997    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175088.5-657s21c1
Sequence:CCGGGGAGGAAACAGGCAAGATAAACTCGAGTTTATCTTGCCTGTTTCCTCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000237996    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175088.5-1038s21c1
Sequence:CCGGTGACATGGACTGCGGCATCATCTCGAGATGATGCCGCAGTCCATGTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000237994    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175088.5-551s21c1
Sequence:CCGGTGATGCGGGACCAGTCCATTTCTCGAGAAATGGACTGGTCCCGCATCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000362509    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175088.5-1513s21c1
Sequence:CCGGGTTTATCTATTGGAGGTTAAACTCGAGTTTAACCTCCAATAGATAAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000362431    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175088.5-1292s21c1
Sequence:CCGGGCCGGATGTATGTGGTTTAATCTCGAGATTAAACCACATACATCCGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000095981    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175088.2-420s1c1
Sequence:CCGGCGAAGCATGTAATGAGGACAACTCGAGTTGTCCTCATTACATGCTTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000095980    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175088.2-680s1c1
Sequence:CCGGCCGTGGAGAATCACAAGATATCTCGAGATATCTTGTGATTCTCCACGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000095982    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175088.2-760s1c1
Sequence:CCGGGACATCAGTAAGAAGAGTAAACTCGAGTTTACTCTTCTTACTGATGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000095979    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175088.2-1231s1c1
Sequence:CCGGCGCCGGATGTATGTGGTTTAACTCGAGTTAAACCACATACATCCGGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000095983    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175088.2-877s1c1
Sequence:CCGGTGCAACATTGTCCTGGGACAACTCGAGTTGTCCCAGGACAATGTTGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_199072
VALIDATED
MDFIC MISSION shRNA Bacterial Glycerol Stock
MyoD family inhibitor domain containing
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000304182    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199072.3-716s21c1
Sequence:CCGGTATAACTCAAGCTACCAATAGCTCGAGCTATTGGTAGCTTGAGTTATATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000300725    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199072.3-940s21c1
Sequence:CCGGCCGCAGATAATCGCAAACTTTCTCGAGAAAGTTTGCGATTATCTGCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000300726    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_199072.3-2370s21c1
Sequence:CCGGGCAGAGAATTGCTACCAGAATCTCGAGATTCTGGTAGCAATTCTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000331291    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199072.3-1285s21c1
Sequence:CCGGGCTTGGAAATCTGTATGGAATCTCGAGATTCCATACAGATTTCCAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107511    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_199072.2-940s1c1
Sequence:CCGGCCGCAGATAATCGCAAACTTTCTCGAGAAAGTTTGCGATTATCTGCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107513    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_199072.2-784s1c1
Sequence:CCGGCTTCGGATGGTGAACTCATTACTCGAGTAATGAGTTCACCATCCGAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107512    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_199072.2-1285s1c1
Sequence:CCGGGCTTGGAAATCTGTATGGAATCTCGAGATTCCATACAGATTTCCAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107510    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_199072.2-2374s1c1
Sequence:CCGGGCAGAGAATTGCTACCAGAATCTCGAGATTCTGGTAGCAATTCTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107514    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_199072.2-783s1c1
Sequence:CCGGCCTTCGGATGGTGAACTCATTCTCGAGAATGAGTTCACCATCCGAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000300666    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199072.3-784s21c1
Sequence:CCGGCTTCGGATGGTGAACTCATTACTCGAGTAATGAGTTCACCATCCGAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_199072
VALIDATED
MDFIC MISSION shRNA shRNA Plasmid DNA
MyoD family inhibitor domain containing
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000304182    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199072.3-716s21c1
Sequence:CCGGTATAACTCAAGCTACCAATAGCTCGAGCTATTGGTAGCTTGAGTTATATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000300725    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199072.3-940s21c1
Sequence:CCGGCCGCAGATAATCGCAAACTTTCTCGAGAAAGTTTGCGATTATCTGCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000300726    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_199072.3-2370s21c1
Sequence:CCGGGCAGAGAATTGCTACCAGAATCTCGAGATTCTGGTAGCAATTCTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000331291    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199072.3-1285s21c1
Sequence:CCGGGCTTGGAAATCTGTATGGAATCTCGAGATTCCATACAGATTTCCAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000107511    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_199072.2-940s1c1
Sequence:CCGGCCGCAGATAATCGCAAACTTTCTCGAGAAAGTTTGCGATTATCTGCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000107513    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_199072.2-784s1c1
Sequence:CCGGCTTCGGATGGTGAACTCATTACTCGAGTAATGAGTTCACCATCCGAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000107512    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_199072.2-1285s1c1
Sequence:CCGGGCTTGGAAATCTGTATGGAATCTCGAGATTCCATACAGATTTCCAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000107510    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_199072.2-2374s1c1
Sequence:CCGGGCAGAGAATTGCTACCAGAATCTCGAGATTCTGGTAGCAATTCTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000107514    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_199072.2-783s1c1
Sequence:CCGGCCTTCGGATGGTGAACTCATTCTCGAGAATGAGTTCACCATCCGAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000300666    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199072.3-784s21c1
Sequence:CCGGCTTCGGATGGTGAACTCATTACTCGAGTAATGAGTTCACCATCCGAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_199072
VALIDATED
MDFIC MISSION shRNA Lentiviral Transduction Particles
MyoD family inhibitor domain containing
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000304182    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199072.3-716s21c1
Sequence:CCGGTATAACTCAAGCTACCAATAGCTCGAGCTATTGGTAGCTTGAGTTATATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000300725    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199072.3-940s21c1
Sequence:CCGGCCGCAGATAATCGCAAACTTTCTCGAGAAAGTTTGCGATTATCTGCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000300726    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_199072.3-2370s21c1
Sequence:CCGGGCAGAGAATTGCTACCAGAATCTCGAGATTCTGGTAGCAATTCTCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000331291    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199072.3-1285s21c1
Sequence:CCGGGCTTGGAAATCTGTATGGAATCTCGAGATTCCATACAGATTTCCAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107511    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_199072.2-940s1c1
Sequence:CCGGCCGCAGATAATCGCAAACTTTCTCGAGAAAGTTTGCGATTATCTGCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107513    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_199072.2-784s1c1
Sequence:CCGGCTTCGGATGGTGAACTCATTACTCGAGTAATGAGTTCACCATCCGAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107512    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_199072.2-1285s1c1
Sequence:CCGGGCTTGGAAATCTGTATGGAATCTCGAGATTCCATACAGATTTCCAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107510    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_199072.2-2374s1c1
Sequence:CCGGGCAGAGAATTGCTACCAGAATCTCGAGATTCTGGTAGCAATTCTCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107514    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_199072.2-783s1c1
Sequence:CCGGCCTTCGGATGGTGAACTCATTCTCGAGAATGAGTTCACCATCCGAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000300666    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199072.3-784s21c1
Sequence:CCGGCTTCGGATGGTGAACTCATTACTCGAGTAATGAGTTCACCATCCGAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)