EMAIL THIS PAGE TO A FRIEND

MDGA1

MAM domain containing glycosylphosphatidylinositol anchor 1

199 Gene Product Result for
Synonyms: GPIM MAMDC3
UniProtKB ID: Q8NFP4, A6NHG0, Q8NBE3
Gene ID:
Mouse(74762) MAM domain containing glycosylphosphatidylinositol anchor 1
Rat(309659) MAM domain containing glycosylphosphatidylinositol anchor 1
chicken(421431) MAM domain containing glycosylphosphatidylinositol anchor 1
domestic cat(101083424) MAM domain containing glycosylphosphatidylinositol anchor 1
cow(536481) MAM domain containing glycosylphosphatidylinositol anchor 1
Horse(100054042) MAM domain containing glycosylphosphatidylinositol anchor 1
dog(474893) MAM domain containing glycosylphosphatidylinositol anchor 1
sheep(101104187) MAM domain containing glycosylphosphatidylinositol anchor 1
naked mole-rat(101702059) MAM domain containing glycosylphosphatidylinositol anchor 1
Domestic Rabbit(100344414) MAM domain containing glycosylphosphatidylinositol anchor 1
domestic guinea pig(100720991) MAM domain containing glycosylphosphatidylinositol anchor 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

ELISA

Product # Description Species Add to Cart
 
RAB1577 Human MDGA1 ELISA for serum, plasma and cell culture supernatants human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_153487 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_153487 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_153487 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001081160 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001081160 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001081160 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_153487 Rosetta Predictions human pricing
NM_001107618 Rosetta Predictions rat pricing
NM_001081160 Rosetta Predictions mouse pricing
XM_193868 Rosetta Predictions mouse pricing
XM_900379 Rosetta Predictions mouse pricing
XM_900398 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153487 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00155189 predicted 2398
2 SASI_Hs01_00155190 predicted 3444
3 SASI_Hs01_00155191 predicted 3401
4 SASI_Hs01_00155192 predicted 2723
5 SASI_Hs02_00367313 predicted 1843
6 SASI_Hs01_00155193 predicted 3578
7 SASI_Hs01_00155194 predicted 1489
8 SASI_Hs01_00155195 predicted 2376
9 SASI_Hs01_00155196 predicted 1306
10 SASI_Hs01_00155198 predicted 1938
11 SASI_Hs01_00155197 predicted 4021
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107618 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00230605 predicted 2882
2 SASI_Rn02_00230606 predicted 1644
3 SASI_Rn02_00230607 predicted 1457
4 SASI_Rn02_00230608 predicted 1395
5 SASI_Rn02_00230609 predicted 3087
6 SASI_Rn02_00230610 predicted 665
7 SASI_Rn02_00230611 predicted 912
8 SASI_Rn02_00230612 predicted 1029
9 SASI_Rn02_00230613 predicted 1905
10 SASI_Rn02_00230614 predicted 2759
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081160 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00295771 predicted 1572
2 SASI_Mm02_00295772 predicted 3111
3 SASI_Mm02_00295773 predicted 1458
4 SASI_Mm02_00295774 predicted 1463
5 SASI_Mm02_00295775 predicted 2830
6 SASI_Mm02_00295776 predicted 916
7 SASI_Mm02_00295777 predicted 1921
8 SASI_Mm02_00295778 predicted 761
9 SASI_Mm02_00295779 predicted 1270
10 SASI_Mm02_00295780 predicted 1501
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_193868 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00216601 predicted 1568
2 SASI_Mm01_00216602 predicted 3121
3 SASI_Mm01_00216603 predicted 1463
4 SASI_Mm01_00216604 predicted 1467
5 SASI_Mm01_00216605 predicted 2834
6 SASI_Mm01_00216606 predicted 922
7 SASI_Mm01_00216607 predicted 1050
8 SASI_Mm01_00216608 predicted 1924
9 SASI_Mm01_00216609 predicted 761
10 SASI_Mm01_00216610 predicted 2845
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_900379 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00228678 predicted 917
2 SASI_Mm01_00228679 predicted 657
3 SASI_Mm01_00228680 predicted 1663
4 SASI_Mm01_00228681 predicted 676
5 SASI_Mm01_00228682 predicted 1121
6 SASI_Mm01_00228683 predicted 846
7 SASI_Mm01_00228684 predicted 761
8 SASI_Mm01_00228685 predicted 637
9 SASI_Mm01_00228686 predicted 907
10 SASI_Mm01_00228687 predicted 587
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_900398 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00233897 predicted 2548
2 SASI_Mm01_00233898 predicted 1967
3 SASI_Mm01_00233899 predicted 1225
4 SASI_Mm01_00233900 predicted 1209
5 SASI_Mm01_00233901 predicted 1295
6 SASI_Mm01_00233902 predicted 2746
7 SASI_Mm01_00233903 predicted 1103
8 SASI_Mm01_00233904 predicted 2465
9 SASI_Mm01_00233905 predicted 560
10 SASI_Mm01_00233906 predicted 2378
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153487
MDGA1 MISSION shRNA Bacterial Glycerol Stock
MAM domain containing glycosylphosphatidylinositol anchor 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000156329    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153487.2-3416s1c1
Sequence:CCGGCGAACCTTTCAGACAACACCTCTCGAGAGGTGTTGTCTGAAAGGTTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155214    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153487.2-2166s1c1
Sequence:CCGGGAAGAACGCTACATTCCAGATCTCGAGATCTGGAATGTAGCGTTCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154541    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153487.2-2159s1c1
Sequence:CCGGGATCCATGAAGAACGCTACATCTCGAGATGTAGCGTTCTTCATGGATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154435    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153487.2-6843s1c1
Sequence:CCGGGCACTGTAAATGTCTAGGCATCTCGAGATGCCTAGACATTTACAGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154397    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153487.2-4692s1c1
Sequence:CCGGCCCAGATTCCTTGACCTATTTCTCGAGAAATAGGTCAAGGAATCTGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154983    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153487.2-5621s1c1
Sequence:CCGGGCCTGAAATTCCACCTTTCATCTCGAGATGAAAGGTGGAATTTCAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158042    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153487.2-2730s1c1
Sequence:CCGGCCGCTATAATGGCTTCAACGTCTCGAGACGTTGAAGCCATTATAGCGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156921    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153487.2-1917s1c1
Sequence:CCGGGAACGAAACTCTGGTGGTGAACTCGAGTTCACCACCAGAGTTTCGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157231    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153487.2-3132s1c1
Sequence:CCGGGCTGTCCAAGAACTACTCCTACTCGAGTAGGAGTAGTTCTTGGACAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153487
MDGA1 MISSION shRNA shRNA Plasmid DNA
MAM domain containing glycosylphosphatidylinositol anchor 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000156329    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153487.2-3416s1c1
Sequence:CCGGCGAACCTTTCAGACAACACCTCTCGAGAGGTGTTGTCTGAAAGGTTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000155214    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153487.2-2166s1c1
Sequence:CCGGGAAGAACGCTACATTCCAGATCTCGAGATCTGGAATGTAGCGTTCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000154541    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153487.2-2159s1c1
Sequence:CCGGGATCCATGAAGAACGCTACATCTCGAGATGTAGCGTTCTTCATGGATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000154435    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153487.2-6843s1c1
Sequence:CCGGGCACTGTAAATGTCTAGGCATCTCGAGATGCCTAGACATTTACAGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000154397    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153487.2-4692s1c1
Sequence:CCGGCCCAGATTCCTTGACCTATTTCTCGAGAAATAGGTCAAGGAATCTGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000154983    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153487.2-5621s1c1
Sequence:CCGGGCCTGAAATTCCACCTTTCATCTCGAGATGAAAGGTGGAATTTCAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000158042    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153487.2-2730s1c1
Sequence:CCGGCCGCTATAATGGCTTCAACGTCTCGAGACGTTGAAGCCATTATAGCGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000156921    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153487.2-1917s1c1
Sequence:CCGGGAACGAAACTCTGGTGGTGAACTCGAGTTCACCACCAGAGTTTCGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000157231    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153487.2-3132s1c1
Sequence:CCGGGCTGTCCAAGAACTACTCCTACTCGAGTAGGAGTAGTTCTTGGACAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153487
MDGA1 MISSION shRNA Lentiviral Transduction Particles
MAM domain containing glycosylphosphatidylinositol anchor 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000156329    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153487.2-3416s1c1
Sequence:CCGGCGAACCTTTCAGACAACACCTCTCGAGAGGTGTTGTCTGAAAGGTTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155214    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153487.2-2166s1c1
Sequence:CCGGGAAGAACGCTACATTCCAGATCTCGAGATCTGGAATGTAGCGTTCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154541    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153487.2-2159s1c1
Sequence:CCGGGATCCATGAAGAACGCTACATCTCGAGATGTAGCGTTCTTCATGGATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154435    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153487.2-6843s1c1
Sequence:CCGGGCACTGTAAATGTCTAGGCATCTCGAGATGCCTAGACATTTACAGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154397    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153487.2-4692s1c1
Sequence:CCGGCCCAGATTCCTTGACCTATTTCTCGAGAAATAGGTCAAGGAATCTGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154983    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153487.2-5621s1c1
Sequence:CCGGGCCTGAAATTCCACCTTTCATCTCGAGATGAAAGGTGGAATTTCAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158042    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153487.2-2730s1c1
Sequence:CCGGCCGCTATAATGGCTTCAACGTCTCGAGACGTTGAAGCCATTATAGCGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156921    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153487.2-1917s1c1
Sequence:CCGGGAACGAAACTCTGGTGGTGAACTCGAGTTCACCACCAGAGTTTCGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157231    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153487.2-3132s1c1
Sequence:CCGGGCTGTCCAAGAACTACTCCTACTCGAGTAGGAGTAGTTCTTGGACAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001081160
MDGA1 MISSION shRNA Bacterial Glycerol Stock
MAM domain containing glycosylphosphatidylinositol anchor 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000267476    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081160.1-3002s21c1
Sequence:CCGGGTGGGCCCTTCCAGATTATTTCTCGAGAAATAATCTGGAAGGGCCCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252980    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081160.1-1649s21c1
Sequence:CCGGTCAGCATAGAGGTCAACATTTCTCGAGAAATGTTGACCTCTATGCTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252982    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081160.1-1468s21c1
Sequence:CCGGGTGAACTATCAGTGGTTTAAACTCGAGTTTAAACCACTGATAGTTCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252979    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081160.1-6424s21c1
Sequence:CCGGACAGGTGTTACTCGAATATTTCTCGAGAAATATTCGAGTAACACCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252981    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081160.1-2977s21c1
Sequence:CCGGCAGGCCCATGTACCCATTAACCTCGAGGTTAATGGGTACATGGGCCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001081160
MDGA1 MISSION shRNA shRNA Plasmid DNA
MAM domain containing glycosylphosphatidylinositol anchor 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000267476    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081160.1-3002s21c1
Sequence:CCGGGTGGGCCCTTCCAGATTATTTCTCGAGAAATAATCTGGAAGGGCCCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000252980    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081160.1-1649s21c1
Sequence:CCGGTCAGCATAGAGGTCAACATTTCTCGAGAAATGTTGACCTCTATGCTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000252982    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081160.1-1468s21c1
Sequence:CCGGGTGAACTATCAGTGGTTTAAACTCGAGTTTAAACCACTGATAGTTCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000252979    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081160.1-6424s21c1
Sequence:CCGGACAGGTGTTACTCGAATATTTCTCGAGAAATATTCGAGTAACACCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000252981    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081160.1-2977s21c1
Sequence:CCGGCAGGCCCATGTACCCATTAACCTCGAGGTTAATGGGTACATGGGCCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001081160
MDGA1 MISSION shRNA Lentiviral Transduction Particles
MAM domain containing glycosylphosphatidylinositol anchor 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000267476    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081160.1-3002s21c1
Sequence:CCGGGTGGGCCCTTCCAGATTATTTCTCGAGAAATAATCTGGAAGGGCCCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252980    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081160.1-1649s21c1
Sequence:CCGGTCAGCATAGAGGTCAACATTTCTCGAGAAATGTTGACCTCTATGCTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252982    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081160.1-1468s21c1
Sequence:CCGGGTGAACTATCAGTGGTTTAAACTCGAGTTTAAACCACTGATAGTTCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252979    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081160.1-6424s21c1
Sequence:CCGGACAGGTGTTACTCGAATATTTCTCGAGAAATATTCGAGTAACACCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252981    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081160.1-2977s21c1
Sequence:CCGGCAGGCCCATGTACCCATTAACCTCGAGGTTAATGGGTACATGGGCCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)