EMAIL THIS PAGE TO A FRIEND

MDGA2

MAM domain containing glycosylphosphatidylinositol anchor 2

182 Gene Product Result for
Synonyms: MAMDC1 c14_5286
UniProtKB ID: Q7Z553, F6W3S7, J3KPX6
Gene ID:
Mouse(320772) MAM domain containing glycosylphosphatidylinositol anchor 2
Rat(314180) MAM domain containing glycosylphosphatidylinositol anchor 2
domestic guinea pig(100723463) MAM domain containing glycosylphosphatidylinositol anchor 2
naked mole-rat(101711448) MAM domain containing glycosylphosphatidylinositol anchor 2
sheep(101121099) MAM domain containing glycosylphosphatidylinositol anchor 2
chicken(423563) MAM domain containing glycosylphosphatidylinositol anchor 2
cow(537506) MAM domain containing glycosylphosphatidylinositol anchor 2
Horse(100064457) MAM domain containing glycosylphosphatidylinositol anchor 2
domestic cat(101090022) MAM domain containing glycosylphosphatidylinositol anchor 2
dog(480310) MAM domain containing glycosylphosphatidylinositol anchor 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_182830 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_182830 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_182830 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_207010 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_207010 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_207010 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU065391 MISSION® esiRNA esiRNA human MAMDC1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001113498 Rosetta Predictions human pricing
NM_182830 Rosetta Predictions human pricing
NM_199269 Rosetta Predictions rat pricing
NM_207010 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001113498 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00325951 predicted 1893
2 SASI_Hs02_00325952 predicted 870
3 SASI_Hs02_00325953 predicted 1096
4 SASI_Hs02_00325954 predicted 1289
5 SASI_Hs02_00325955 predicted 1587
6 SASI_Hs02_00325956 predicted 1846
7 SASI_Hs02_00325957 predicted 2687
8 SASI_Hs02_00325958 predicted 933
9 SASI_Hs02_00325959 predicted 1356
10 SASI_Hs02_00325960 predicted 1925
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_182830 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00199554 predicted 1754
2 SASI_Hs01_00199555 predicted 959
3 SASI_Hs01_00199556 predicted 1156
4 SASI_Hs01_00199558 predicted 1449
5 SASI_Hs01_00199559 predicted 1714
6 SASI_Hs02_00370962 predicted 2550
7 SASI_Hs01_00199560 predicted 797
8 SASI_Hs02_00370963 predicted 781
9 SASI_Hs01_00199561 predicted 1220
10 SASI_Hs01_00199563 predicted 1791
11 SASI_Hs01_00199557 predicted 2646
12 SASI_Hs01_00199562 predicted 2263
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_199269 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00270166 predicted 576
2 SASI_Rn01_00044958 predicted 1951
3 SASI_Rn01_00044959 predicted 2265
4 SASI_Rn01_00044960 predicted 2878
5 SASI_Rn01_00044961 predicted 1454
6 SASI_Rn01_00044962 predicted 1911
7 SASI_Rn01_00044963 predicted 2810
8 SASI_Rn01_00044964 predicted 1959
9 SASI_Rn01_00044965 predicted 1282
10 SASI_Rn01_00044966 predicted 2737
11 SASI_Rn01_00044967 predicted 2408
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_207010 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00188330 predicted 2300
2 SASI_Mm01_00188331 predicted 2328
3 SASI_Mm01_00188332 predicted 545
4 SASI_Mm01_00188334 predicted 831
5 SASI_Mm02_00351854 predicted 2428
6 SASI_Mm01_00188335 predicted 436
7 SASI_Mm02_00351855 predicted 900
8 SASI_Mm01_00188336 predicted 560
9 SASI_Mm01_00188337 predicted 1065
10 SASI_Mm02_00351856 predicted 1889
11 SASI_Mm01_00188329 predicted 1950
12 SASI_Mm01_00188333 predicted 2629
13 SASI_Mm01_00188338 predicted 860
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_182830
MDGA2 MISSION shRNA Bacterial Glycerol Stock
MAM domain containing glycosylphosphatidylinositol anchor 2
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000356225    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182830.3-1341s21c1
Sequence:CCGGTGATATCAGTATCGATGTTAACTCGAGTTAACATCGATACTGATATCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000356168    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182830.3-2166s21c1
Sequence:CCGGTAACTTGACAGAGCTAATTAACTCGAGTTAATTAGCTCTGTCAAGTTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006963    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_182830.2-3927s1c1
Sequence:CCGGCGGCTTATTGTCCATTAGAAACTCGAGTTTCTAATGGACAATAAGCCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006967    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182830.2-2506s1c1
Sequence:CCGGCCACAAACACTGCATATTGTTCTCGAGAACAATATGCAGTGTTTGTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006966    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182830.2-1475s1c1
Sequence:CCGGGCCTGATGGATCAATGCAAATCTCGAGATTTGCATTGATCCATCAGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006965    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182830.2-1882s1c1
Sequence:CCGGGCAGCTTTCTTGTTACAGGAACTCGAGTTCCTGTAACAAGAAAGCTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_182830
MDGA2 MISSION shRNA shRNA Plasmid DNA
MAM domain containing glycosylphosphatidylinositol anchor 2
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000356225    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182830.3-1341s21c1
Sequence:CCGGTGATATCAGTATCGATGTTAACTCGAGTTAACATCGATACTGATATCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000356168    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182830.3-2166s21c1
Sequence:CCGGTAACTTGACAGAGCTAATTAACTCGAGTTAATTAGCTCTGTCAAGTTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006963    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_182830.2-3927s1c1
Sequence:CCGGCGGCTTATTGTCCATTAGAAACTCGAGTTTCTAATGGACAATAAGCCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006967    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182830.2-2506s1c1
Sequence:CCGGCCACAAACACTGCATATTGTTCTCGAGAACAATATGCAGTGTTTGTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006966    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182830.2-1475s1c1
Sequence:CCGGGCCTGATGGATCAATGCAAATCTCGAGATTTGCATTGATCCATCAGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006965    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182830.2-1882s1c1
Sequence:CCGGGCAGCTTTCTTGTTACAGGAACTCGAGTTCCTGTAACAAGAAAGCTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_182830
MDGA2 MISSION shRNA Lentiviral Transduction Particles
MAM domain containing glycosylphosphatidylinositol anchor 2
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000356225    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182830.3-1341s21c1
Sequence:CCGGTGATATCAGTATCGATGTTAACTCGAGTTAACATCGATACTGATATCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000356168    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182830.3-2166s21c1
Sequence:CCGGTAACTTGACAGAGCTAATTAACTCGAGTTAATTAGCTCTGTCAAGTTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006963    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_182830.2-3927s1c1
Sequence:CCGGCGGCTTATTGTCCATTAGAAACTCGAGTTTCTAATGGACAATAAGCCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006967    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182830.2-2506s1c1
Sequence:CCGGCCACAAACACTGCATATTGTTCTCGAGAACAATATGCAGTGTTTGTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006966    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182830.2-1475s1c1
Sequence:CCGGGCCTGATGGATCAATGCAAATCTCGAGATTTGCATTGATCCATCAGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006965    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182830.2-1882s1c1
Sequence:CCGGGCAGCTTTCTTGTTACAGGAACTCGAGTTCCTGTAACAAGAAAGCTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_207010
MDGA2 MISSION shRNA Bacterial Glycerol Stock
MAM domain containing glycosylphosphatidylinositol anchor 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000030459    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207010.1-782s1c1
Sequence:CCGGCCCTCAAGATTATGCTAACTACTCGAGTAGTTAGCATAATCTTGAGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000030460    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207010.1-2428s1c1
Sequence:CCGGCGGATAACTTTGACTGGACAACTCGAGTTGTCCAGTCAAAGTTATCCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000030461    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207010.1-1351s1c1
Sequence:CCGGCCGGAACAACAAACTTGGATACTCGAGTATCCAAGTTTGTTGTTCCGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000030462    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207010.1-1949s1c1
Sequence:CCGGCCCACTAAAGAGTCTTTCCAACTCGAGTTGGAAAGACTCTTTAGTGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000030463    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207010.1-2769s1c1
Sequence:CCGGCGATGGAATGAAGCTCATGTTCTCGAGAACATGAGCTTCATTCCATCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_207010
MDGA2 MISSION shRNA shRNA Plasmid DNA
MAM domain containing glycosylphosphatidylinositol anchor 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000030459    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207010.1-782s1c1
Sequence:CCGGCCCTCAAGATTATGCTAACTACTCGAGTAGTTAGCATAATCTTGAGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000030460    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207010.1-2428s1c1
Sequence:CCGGCGGATAACTTTGACTGGACAACTCGAGTTGTCCAGTCAAAGTTATCCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000030461    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207010.1-1351s1c1
Sequence:CCGGCCGGAACAACAAACTTGGATACTCGAGTATCCAAGTTTGTTGTTCCGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000030462    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207010.1-1949s1c1
Sequence:CCGGCCCACTAAAGAGTCTTTCCAACTCGAGTTGGAAAGACTCTTTAGTGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000030463    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207010.1-2769s1c1
Sequence:CCGGCGATGGAATGAAGCTCATGTTCTCGAGAACATGAGCTTCATTCCATCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_207010
MDGA2 MISSION shRNA Lentiviral Transduction Particles
MAM domain containing glycosylphosphatidylinositol anchor 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000030459    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207010.1-782s1c1
Sequence:CCGGCCCTCAAGATTATGCTAACTACTCGAGTAGTTAGCATAATCTTGAGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000030460    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207010.1-2428s1c1
Sequence:CCGGCGGATAACTTTGACTGGACAACTCGAGTTGTCCAGTCAAAGTTATCCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000030461    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207010.1-1351s1c1
Sequence:CCGGCCGGAACAACAAACTTGGATACTCGAGTATCCAAGTTTGTTGTTCCGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000030462    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207010.1-1949s1c1
Sequence:CCGGCCCACTAAAGAGTCTTTCCAACTCGAGTTGGAAAGACTCTTTAGTGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000030463    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207010.1-2769s1c1
Sequence:CCGGCGATGGAATGAAGCTCATGTTCTCGAGAACATGAGCTTCATTCCATCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)