EMAIL THIS PAGE TO A FRIEND

MDH1

malate dehydrogenase 1, NAD (soluble)

72 Gene Product Result for
Synonyms: MDH-s MDHA MGC:1375 MOR2
UniProtKB ID: P40925, B2R5V5, B4DUN2, B7Z3I7, F5H098, Q6I9V0
Gene ID:
Human(4190) Summary: Malate dehydrogenase catalyzes the reversible oxidation of malate to oxaloacetate, utilizing the NAD/NADH cofactor system in the citric acid cycle. The protein encoded by this gene is localized to the cytoplasm and may play pivotal roles in the malate-aspartate shuttle that operates in the metabolic coordination between cytosol and mitochondria. Alternatively spliced transcript variants encoding distinct isoforms have been found for this gene.[provided by RefSeq, Nov 2010]
Mouse(17449) malate dehydrogenase 1, NAD (soluble)
Rat(24551) malate dehydrogenase 1, NAD (soluble)
fruit fly(5656948) Malate dehydrogenase 1
cow(535182) malate dehydrogenase 1, NAD (soluble)
domestic cat(493924) malate dehydrogenase 1, NAD (soluble)
dog(474614) malate dehydrogenase 1, NAD (soluble)
fruit fly(34414) Malate dehydrogenase 1
chicken(421281) malate dehydrogenase 1, NAD (soluble)
sheep(101116035) malate dehydrogenase 1, NAD (soluble)
naked mole-rat(101719728) malate dehydrogenase 1, NAD (soluble)
domestic guinea pig(100734239) malate dehydrogenase 1, NAD (soluble)
Gene Class: Dehydrogenase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Kits

Product # Description Species Add to Cart
 
MAK196 Malate Dehydrogenase Assay Kit Sufficient for 100 Colorimetric tests human, mouse, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005917 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005917 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005917 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008618 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008618 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008618 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005917 Rosetta Predictions human pricing
NM_033235 Rosetta Predictions rat pricing
NM_008618 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005917 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00031429 predicted 862
2 SASI_Hs01_00031430 predicted 661
3 SASI_Hs01_00031432 predicted 541
4 SASI_Hs01_00031433 predicted 906
5 SASI_Hs01_00031434 predicted 864
6 SASI_Hs01_00031435 predicted 879
7 SASI_Hs01_00031436 predicted 600
8 SASI_Hs01_00031437 predicted 956
9 SASI_Hs01_00031438 predicted 423
10 SASI_Hs02_00340542 predicted 302
11 SASI_Hs01_00031431 predicted 449
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033235 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00116133 predicted 287
2 SASI_Rn01_00116134 predicted 600
3 SASI_Rn01_00116135 predicted 653
4 SASI_Rn01_00116136 predicted 403
5 SASI_Rn01_00116137 predicted 378
6 SASI_Rn01_00116138 predicted 522
7 SASI_Rn02_00265519 predicted 321
8 SASI_Rn01_00116139 predicted 553
9 SASI_Rn01_00116140 predicted 833
10 SASI_Rn01_00116141 predicted 842
11 SASI_Rn01_00116142 predicted 914
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008618 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00185314 predicted 702
2 SASI_Mm01_00185320 predicted 581
3 SASI_Mm01_00185321 predicted 463
4 SASI_Mm02_00314295 predicted 604
5 SASI_Mm02_00314296 predicted 446
6 SASI_Mm01_00185315 predicted 675
7 SASI_Mm02_00314297 predicted 613
8 SASI_Mm02_00314298 predicted 438
9 SASI_Mm01_00185317 predicted 290
10 SASI_Mm01_00185318 predicted 391
11 SASI_Mm01_00185316 predicted 1089
12 SASI_Mm01_00185319 predicted 1081
13 SASI_Mm01_00185322 predicted 718
14 SASI_Mm01_00185323 predicted 1167
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005917
VALIDATED
MDH1 MISSION shRNA Bacterial Glycerol Stock
malate dehydrogenase 1, NAD (soluble)
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000028566    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_005917.2-264s1c1
Sequence:CCGGGCAACAGATAAAGAAGACGTTCTCGAGAACGTCTTCTTTATCTGTTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028492    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_005917.2-158s1c1
Sequence:CCGGGCCTATAATTCTTGTGCTGTTCTCGAGAACAGCACAAGAATTATAGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028484    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_005917.2-509s1c1
Sequence:CCGGCTTCAGTTGCTTGACTCGTTTCTCGAGAAACGAGTCAAGCAACTGAAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028551    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_005917.2-920s1c1
Sequence:CCGGCCCTGTTGTAATCAAGAATAACTCGAGTTATTCTTGATTACAACAGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028547    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005917.2-401s1c1
Sequence:CCGGCTTAGATAAATACGCCAAGAACTCGAGTTCTTGGCGTATTTATCTAAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275246    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005917.2-954s21c1
Sequence:CCGGGTTGAAGGTCTCCCTATTAATCTCGAGATTAATAGGGAGACCTTCAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275198    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_005917.2-158s21c1
Sequence:CCGGGCCTATAATTCTTGTGCTGTTCTCGAGAACAGCACAAGAATTATAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275199    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_005917.2-509s21c1
Sequence:CCGGCTTCAGTTGCTTGACTCGTTTCTCGAGAAACGAGTCAAGCAACTGAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275248    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005917.2-920s21c1
Sequence:CCGGCCCTGTTGTAATCAAGAATAACTCGAGTTATTCTTGATTACAACAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000285325    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_005917.2-1097s21c1
Sequence:CCGGAGAATCTAAATGTCGTCTTTGCTCGAGCAAAGACGACATTTAGATTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005917
VALIDATED
MDH1 MISSION shRNA shRNA Plasmid DNA
malate dehydrogenase 1, NAD (soluble)
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000028566    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_005917.2-264s1c1
Sequence:CCGGGCAACAGATAAAGAAGACGTTCTCGAGAACGTCTTCTTTATCTGTTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000028492    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_005917.2-158s1c1
Sequence:CCGGGCCTATAATTCTTGTGCTGTTCTCGAGAACAGCACAAGAATTATAGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000028484    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_005917.2-509s1c1
Sequence:CCGGCTTCAGTTGCTTGACTCGTTTCTCGAGAAACGAGTCAAGCAACTGAAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000028551    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_005917.2-920s1c1
Sequence:CCGGCCCTGTTGTAATCAAGAATAACTCGAGTTATTCTTGATTACAACAGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000028547    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005917.2-401s1c1
Sequence:CCGGCTTAGATAAATACGCCAAGAACTCGAGTTCTTGGCGTATTTATCTAAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000275246    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005917.2-954s21c1
Sequence:CCGGGTTGAAGGTCTCCCTATTAATCTCGAGATTAATAGGGAGACCTTCAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000275198    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_005917.2-158s21c1
Sequence:CCGGGCCTATAATTCTTGTGCTGTTCTCGAGAACAGCACAAGAATTATAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000275199    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_005917.2-509s21c1
Sequence:CCGGCTTCAGTTGCTTGACTCGTTTCTCGAGAAACGAGTCAAGCAACTGAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000275248    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005917.2-920s21c1
Sequence:CCGGCCCTGTTGTAATCAAGAATAACTCGAGTTATTCTTGATTACAACAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000285325    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_005917.2-1097s21c1
Sequence:CCGGAGAATCTAAATGTCGTCTTTGCTCGAGCAAAGACGACATTTAGATTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005917
VALIDATED
MDH1 MISSION shRNA Lentiviral Transduction Particles
malate dehydrogenase 1, NAD (soluble)
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000028566    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_005917.2-264s1c1
Sequence:CCGGGCAACAGATAAAGAAGACGTTCTCGAGAACGTCTTCTTTATCTGTTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028492    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_005917.2-158s1c1
Sequence:CCGGGCCTATAATTCTTGTGCTGTTCTCGAGAACAGCACAAGAATTATAGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028484    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_005917.2-509s1c1
Sequence:CCGGCTTCAGTTGCTTGACTCGTTTCTCGAGAAACGAGTCAAGCAACTGAAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028551    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_005917.2-920s1c1
Sequence:CCGGCCCTGTTGTAATCAAGAATAACTCGAGTTATTCTTGATTACAACAGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028547    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005917.2-401s1c1
Sequence:CCGGCTTAGATAAATACGCCAAGAACTCGAGTTCTTGGCGTATTTATCTAAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275246    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005917.2-954s21c1
Sequence:CCGGGTTGAAGGTCTCCCTATTAATCTCGAGATTAATAGGGAGACCTTCAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275198    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_005917.2-158s21c1
Sequence:CCGGGCCTATAATTCTTGTGCTGTTCTCGAGAACAGCACAAGAATTATAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275199    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_005917.2-509s21c1
Sequence:CCGGCTTCAGTTGCTTGACTCGTTTCTCGAGAAACGAGTCAAGCAACTGAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275248    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005917.2-920s21c1
Sequence:CCGGCCCTGTTGTAATCAAGAATAACTCGAGTTATTCTTGATTACAACAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000285325    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_005917.2-1097s21c1
Sequence:CCGGAGAATCTAAATGTCGTCTTTGCTCGAGCAAAGACGACATTTAGATTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008618
VALIDATED
MDH1 MISSION shRNA Bacterial Glycerol Stock
malate dehydrogenase 1, NAD (soluble)
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000041803    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008618.2-690s1c1
Sequence:CCGGCCAAGGTGAAACTGCAAGGAACTCGAGTTCCTTGCAGTTTCACCTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041804    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008618.2-199s1c1
Sequence:CCGGGCCCATCATTCTTGTGCTGTTCTCGAGAACAGCACAAGAATGATGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041805    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008618.2-961s1c1
Sequence:CCGGCCCTGTCGTGATCAAGAATAACTCGAGTTATTCTTGATCACGACAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041806    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008618.2-442s1c1
Sequence:CCGGCTTGGAGAAATACGCCAAGAACTCGAGTTCTTGGCGTATTTCTCCAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041807    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008618.2-892s1c1
Sequence:CCGGGTTCGTGTCGATGGGTGTTATCTCGAGATAACACCCATCGACACGAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000308710    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008618.2-690s21c1
Sequence:CCGGCCAAGGTGAAACTGCAAGGAACTCGAGTTCCTTGCAGTTTCACCTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000308711    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008618.2-892s21c1
Sequence:CCGGGTTCGTGTCGATGGGTGTTATCTCGAGATAACACCCATCGACACGAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000308650    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008618.2-961s21c1
Sequence:CCGGCCCTGTCGTGATCAAGAATAACTCGAGTTATTCTTGATCACGACAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000308651    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008618.2-442s21c1
Sequence:CCGGCTTGGAGAAATACGCCAAGAACTCGAGTTCTTGGCGTATTTCTCCAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000308712    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008618.2-199s21c1
Sequence:CCGGGCCCATCATTCTTGTGCTGTTCTCGAGAACAGCACAAGAATGATGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008618
VALIDATED
MDH1 MISSION shRNA shRNA Plasmid DNA
malate dehydrogenase 1, NAD (soluble)
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000041803    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008618.2-690s1c1
Sequence:CCGGCCAAGGTGAAACTGCAAGGAACTCGAGTTCCTTGCAGTTTCACCTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000041804    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008618.2-199s1c1
Sequence:CCGGGCCCATCATTCTTGTGCTGTTCTCGAGAACAGCACAAGAATGATGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000041805    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008618.2-961s1c1
Sequence:CCGGCCCTGTCGTGATCAAGAATAACTCGAGTTATTCTTGATCACGACAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000041806    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008618.2-442s1c1
Sequence:CCGGCTTGGAGAAATACGCCAAGAACTCGAGTTCTTGGCGTATTTCTCCAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000041807    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008618.2-892s1c1
Sequence:CCGGGTTCGTGTCGATGGGTGTTATCTCGAGATAACACCCATCGACACGAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000308710    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008618.2-690s21c1
Sequence:CCGGCCAAGGTGAAACTGCAAGGAACTCGAGTTCCTTGCAGTTTCACCTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000308711    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008618.2-892s21c1
Sequence:CCGGGTTCGTGTCGATGGGTGTTATCTCGAGATAACACCCATCGACACGAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000308650    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008618.2-961s21c1
Sequence:CCGGCCCTGTCGTGATCAAGAATAACTCGAGTTATTCTTGATCACGACAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000308651    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008618.2-442s21c1
Sequence:CCGGCTTGGAGAAATACGCCAAGAACTCGAGTTCTTGGCGTATTTCTCCAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000308712    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008618.2-199s21c1
Sequence:CCGGGCCCATCATTCTTGTGCTGTTCTCGAGAACAGCACAAGAATGATGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008618
VALIDATED
MDH1 MISSION shRNA Lentiviral Transduction Particles
malate dehydrogenase 1, NAD (soluble)
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000041803    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008618.2-690s1c1
Sequence:CCGGCCAAGGTGAAACTGCAAGGAACTCGAGTTCCTTGCAGTTTCACCTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041804    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008618.2-199s1c1
Sequence:CCGGGCCCATCATTCTTGTGCTGTTCTCGAGAACAGCACAAGAATGATGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041805    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008618.2-961s1c1
Sequence:CCGGCCCTGTCGTGATCAAGAATAACTCGAGTTATTCTTGATCACGACAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041806    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008618.2-442s1c1
Sequence:CCGGCTTGGAGAAATACGCCAAGAACTCGAGTTCTTGGCGTATTTCTCCAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041807    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008618.2-892s1c1
Sequence:CCGGGTTCGTGTCGATGGGTGTTATCTCGAGATAACACCCATCGACACGAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000308710    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008618.2-690s21c1
Sequence:CCGGCCAAGGTGAAACTGCAAGGAACTCGAGTTCCTTGCAGTTTCACCTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000308711    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008618.2-892s21c1
Sequence:CCGGGTTCGTGTCGATGGGTGTTATCTCGAGATAACACCCATCGACACGAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000308650    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008618.2-961s21c1
Sequence:CCGGCCCTGTCGTGATCAAGAATAACTCGAGTTATTCTTGATCACGACAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000308651    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008618.2-442s21c1
Sequence:CCGGCTTGGAGAAATACGCCAAGAACTCGAGTTCTTGGCGTATTTCTCCAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000308712    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008618.2-199s21c1
Sequence:CCGGGCCCATCATTCTTGTGCTGTTCTCGAGAACAGCACAAGAATGATGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)