EMAIL THIS PAGE TO A FRIEND

MDH1B

malate dehydrogenase 1B, NAD (soluble)

102 Gene Product Result for
Synonyms: RP11-95H11
UniProtKB ID: Q5I0G3, A8K8M1, Q53TK9, Q8IV51
Gene ID:
Mouse(76668) malate dehydrogenase 1B, NAD (soluble)
Rat(316444) malate dehydrogenase 1B, NAD (soluble)
Zebrafish(335715) malate dehydrogenase 1b, NAD (soluble)
domestic cat(101096753) malate dehydrogenase 1B, NAD (soluble)
Horse(100068671) malate dehydrogenase 1B, NAD (soluble)
cow(527943) malate dehydrogenase 1B, NAD (soluble)
dog(478883) malate dehydrogenase 1B, NAD (soluble)
chicken(424097) malate dehydrogenase 1B, NAD (soluble)
domestic guinea pig(100718047) malate dehydrogenase 1B, NAD (soluble)
naked mole-rat(101714987) malate dehydrogenase 1B, NAD (soluble)
sheep(101105807) malate dehydrogenase 1B, NAD (soluble)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039845 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00121256 predicted 1270
2 SASI_Hs01_00121257 predicted 1516
3 SASI_Hs01_00121258 predicted 532
4 SASI_Hs01_00121259 predicted 1450
5 SASI_Hs02_00308685 predicted 1257
6 SASI_Hs01_00121261 predicted 1317
7 SASI_Hs01_00121262 predicted 509
8 SASI_Hs01_00121263 predicted 1378
9 SASI_Hs01_00121264 predicted 879
10 SASI_Hs02_00308686 predicted 529
11 SASI_Hs01_00121260 predicted 1537
12 SASI_Hs01_00121265 predicted 1410
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108221 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00236514 predicted 1061
2 SASI_Rn02_00236515 predicted 914
3 SASI_Rn02_00236516 predicted 1115
4 SASI_Rn02_00236517 predicted 841
5 SASI_Rn02_00236518 predicted 1226
6 SASI_Rn02_00236519 predicted 389
7 SASI_Rn02_00236520 predicted 282
8 SASI_Rn02_00236521 predicted 786
9 SASI_Rn02_00236522 predicted 1312
10 SASI_Rn02_00236523 predicted 203
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_029696 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00112632 predicted 1036
2 SASI_Mm01_00112633 predicted 928
3 SASI_Mm01_00112634 predicted 899
4 SASI_Mm02_00335740 predicted 523
5 SASI_Mm01_00112637 predicted 1087
6 SASI_Mm01_00112638 predicted 1445
7 SASI_Mm01_00112639 predicted 1435
8 SASI_Mm01_00112640 predicted 758
9 SASI_Mm02_00335741 predicted 959
10 SASI_Mm01_00112641 predicted 1288
11 SASI_Mm01_00112635 predicted 1327
12 SASI_Mm01_00112636 predicted 839
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_029696
MDH1B MISSION shRNA Bacterial Glycerol Stock
malate dehydrogenase 1B, NAD (soluble)
Mouse
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000248776    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029696.4-449s21c1
Sequence:CCGGTTACGTGTGCTGCCACTTAATCTCGAGATTAAGTGGCAGCACACGTAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000215837    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029696.3-934s1c1
Sequence:CCGGCCAACATCAAAGATGTGATAACTCGAGTTATCACATCTTTGATGTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248779    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029696.4-1392s21c1
Sequence:CCGGGTTGCATGTGGAGACTTATTACTCGAGTAATAAGTCTCCACATGCAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248777    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029696.4-1530s21c1
Sequence:CCGGTAGCTTCAACCAGAACAAATACTCGAGTATTTGTTCTGGTTGAAGCTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248778    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029696.4-333s21c1
Sequence:CCGGTTGATGATGGTCATCGCTAAACTCGAGTTTAGCGATGACCATCATCAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183112    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_029696.2-1539s1c1
Sequence:CCGGCCAGAACAAATATGAAGGAAACTCGAGTTTCCTTCATATTTGTTCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_029696
MDH1B MISSION shRNA shRNA Plasmid DNA
malate dehydrogenase 1B, NAD (soluble)
Mouse
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000248776    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029696.4-449s21c1
Sequence:CCGGTTACGTGTGCTGCCACTTAATCTCGAGATTAAGTGGCAGCACACGTAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000215837    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029696.3-934s1c1
Sequence:CCGGCCAACATCAAAGATGTGATAACTCGAGTTATCACATCTTTGATGTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000248779    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029696.4-1392s21c1
Sequence:CCGGGTTGCATGTGGAGACTTATTACTCGAGTAATAAGTCTCCACATGCAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000248777    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029696.4-1530s21c1
Sequence:CCGGTAGCTTCAACCAGAACAAATACTCGAGTATTTGTTCTGGTTGAAGCTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000248778    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029696.4-333s21c1
Sequence:CCGGTTGATGATGGTCATCGCTAAACTCGAGTTTAGCGATGACCATCATCAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000183112    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_029696.2-1539s1c1
Sequence:CCGGCCAGAACAAATATGAAGGAAACTCGAGTTTCCTTCATATTTGTTCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_029696
MDH1B MISSION shRNA Lentiviral Transduction Particles
malate dehydrogenase 1B, NAD (soluble)
Mouse
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000248776    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029696.4-449s21c1
Sequence:CCGGTTACGTGTGCTGCCACTTAATCTCGAGATTAAGTGGCAGCACACGTAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000215837    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029696.3-934s1c1
Sequence:CCGGCCAACATCAAAGATGTGATAACTCGAGTTATCACATCTTTGATGTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248779    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029696.4-1392s21c1
Sequence:CCGGGTTGCATGTGGAGACTTATTACTCGAGTAATAAGTCTCCACATGCAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248777    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029696.4-1530s21c1
Sequence:CCGGTAGCTTCAACCAGAACAAATACTCGAGTATTTGTTCTGGTTGAAGCTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248778    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029696.4-333s21c1
Sequence:CCGGTTGATGATGGTCATCGCTAAACTCGAGTTTAGCGATGACCATCATCAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183112    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_029696.2-1539s1c1
Sequence:CCGGCCAGAACAAATATGAAGGAAACTCGAGTTTCCTTCATATTTGTTCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_206892
MDH1B MISSION shRNA Bacterial Glycerol Stock
malate dehydrogenase 1B, NAD (soluble)
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000025863    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_206892.1-753s1c1
Sequence:CCGGGCACTTGGAGACAAGATACATCTCGAGATGTATCTTGTCTCCAAGTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025798    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_206892.1-516s1c1
Sequence:CCGGGCACACAGTATAGCCACTACACTCGAGTGTAGTGGCTATACTGTGTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025826    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_206892.1-322s1c1
Sequence:CCGGCGACTGAACTGATGATGGTAACTCGAGTTACCATCATCAGTTCAGTCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025811    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_206892.1-716s1c1
Sequence:CCGGCCGAATGACAAGTGATCTAATCTCGAGATTAGATCACTTGTCATTCGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025816    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_206892.1-75s1c1
Sequence:CCGGACAGAACTTGTGGCAGACTATCTCGAGATAGTCTGCCACAAGTTCTGTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_206892
MDH1B MISSION shRNA shRNA Plasmid DNA
malate dehydrogenase 1B, NAD (soluble)
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000025863    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_206892.1-753s1c1
Sequence:CCGGGCACTTGGAGACAAGATACATCTCGAGATGTATCTTGTCTCCAAGTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000025798    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_206892.1-516s1c1
Sequence:CCGGGCACACAGTATAGCCACTACACTCGAGTGTAGTGGCTATACTGTGTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000025826    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_206892.1-322s1c1
Sequence:CCGGCGACTGAACTGATGATGGTAACTCGAGTTACCATCATCAGTTCAGTCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000025811    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_206892.1-716s1c1
Sequence:CCGGCCGAATGACAAGTGATCTAATCTCGAGATTAGATCACTTGTCATTCGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000025816    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_206892.1-75s1c1
Sequence:CCGGACAGAACTTGTGGCAGACTATCTCGAGATAGTCTGCCACAAGTTCTGTTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_206892
MDH1B MISSION shRNA Lentiviral Transduction Particles
malate dehydrogenase 1B, NAD (soluble)
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000025863    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_206892.1-753s1c1
Sequence:CCGGGCACTTGGAGACAAGATACATCTCGAGATGTATCTTGTCTCCAAGTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025798    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_206892.1-516s1c1
Sequence:CCGGGCACACAGTATAGCCACTACACTCGAGTGTAGTGGCTATACTGTGTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025826    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_206892.1-322s1c1
Sequence:CCGGCGACTGAACTGATGATGGTAACTCGAGTTACCATCATCAGTTCAGTCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025811    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_206892.1-716s1c1
Sequence:CCGGCCGAATGACAAGTGATCTAATCTCGAGATTAGATCACTTGTCATTCGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025816    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_206892.1-75s1c1
Sequence:CCGGACAGAACTTGTGGCAGACTATCTCGAGATAGTCTGCCACAAGTTCTGTTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)