EMAIL THIS PAGE TO A FRIEND

MDM2

MDM2 oncogene, E3 ubiquitin protein ligase

127 Gene Product Result for
Synonyms: ACTFS HDMX hdm2
Gene ID:
Human(4193) Summary: This gene encodes a nuclear-localized E3 ubiquitin ligase. The encoded protein can promote tumor formation by targeting tumor suppressor proteins, such as p53, for proteasomal degradation. This gene is itself transcriptionally-regulated by p53. Overexpression or amplification of this locus is detected in a variety of different cancers. There is a pseudogene for this gene on chromosome 2. Alternative splicing results in a multitude of transcript variants, many of which may be expressed only in tumor cells. [provided by RefSeq, Jun 2013]
Mouse(17246) transformed mouse 3T3 cell double minute 2
Rat(314856) p53 E3 ubiquitin protein ligase
Zebrafish(30637) transformed 3T3 cell double minute 2 homolog (mouse)
dog(403693) Mdm2, p53 E3 ubiquitin protein ligase homolog (mouse)
domestic cat(493939) Mdm2, p53 E3 ubiquitin protein ligase homolog (mouse)
cow(540378) Mdm2, p53 E3 ubiquitin protein ligase homolog (mouse)
Horse(100033891) Mdm2, p53 E3 ubiquitin protein ligase homolog (mouse)
chicken(395609) Mdm2, p53 E3 ubiquitin protein ligase homolog (mouse)
domestic guinea pig(100724684) MDM2 oncogene, E3 ubiquitin protein ligase
naked mole-rat(101724821) MDM2 oncogene, E3 ubiquitin protein ligase
sheep(101104979) Mdm2, p53 E3 ubiquitin protein ligase homolog (mouse)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4300601 Anti-MDM2 (Ab-166) antibody produced in rabbit affinity isolated antibody human
immunofluorescence, immunohistochemistry, western blot pricing
SAB2500625 Anti-MDM2 (Isoform) antibody produced in goat affinity isolated antibody, buffered aqueous solution canine, human, cat
ELISA, western blot pricing
M7815 Anti-MDM2 antibody ,Mouse monoclonal clone HDM2-323, purified from hybridoma cell culture mouse, human
ELISA, microarray, western blot pricing
GW21160 Anti-MDM2 antibody produced in chicken affinity isolated antibody, buffered aqueous solution mouse, rat, human
western blot pricing
SAB4501849 Anti-MDM2 antibody produced in rabbit affinity isolated antibody human, mouse
ELISA, immunofluorescence, western blot pricing
SAB4501850 Anti-MDM2 antibody produced in rabbit affinity isolated antibody human
ELISA, immunofluorescence, immunohistochemistry pricing
SAB4501851 Anti-MDM2 antibody produced in rabbit affinity isolated antibody mouse, human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB4300284 Anti-phospho-MDM2 (pSer166) antibody produced in rabbit affinity isolated antibody human
immunofluorescence, immunohistochemistry, western blot pricing
SAB4503937 Anti-phospho-MDM2 (pSer166) antibody produced in rabbit affinity isolated antibody human, mouse, rat
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB4504281 Anti-phospho-MDM2 (pSer186+Ser188) antibody produced in rabbit affinity isolated antibody rat, human, mouse
ELISA, immunofluorescence pricing
SAB4301268 Anti-phospho-MDM2 (pSer186/Ser188) antibody produced in rabbit affinity isolated antibody human
immunohistochemistry pricing
WH0004193M1 Monoclonal Anti-MDM2 antibody produced in mouse clone 1A7, purified immunoglobulin, buffered aqueous solution human, rat, mouse
ELISA, proximity ligation assay, western blot pricing
M8558 Monoclonal Anti-MDM2 antibody produced in mouse ~2 mg/mL, clone MD-219, purified immunoglobulin, buffered aqueous solution mouse
ELISA, flow cytometry, immunocytochemistry, microarray, western blot pricing
M4308 Monoclonal Anti-MDM2 antibody produced in mouse clone SMP14, ascites fluid rat, human, mouse (weak)
ELISA, immunocytochemistry, immunohistochemistry, immunoprecipitation (IP), microarray, western blot pricing

ELISA

Product # Description Species Add to Cart
 
RAB1578 Human MDM2 ELISA for serum, plasma and cell culture supernatants human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002392 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002392 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002392 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010786 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010786 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010786 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Related Products

Product # Description Species Add to Cart
 
07-575 Anti-MDM2 Antibody Detect MDM2 also known as Murine Double Minute 2 with Anti-MDM2 Antibody (Rabbit Polyclonal Antibody), that has been demonstrated to work in WB. pricing
MABE281 Anti-MDM2 Antibody, clone 2A10 Anti-MDM2 Antibody, clone 2A10 is a Mouse Monoclonal Antibody for detection of MDM2 also known as E3 ubiquitin-protein ligase Mdm2 or Hdm2 & has been validated in WB & IP. pricing
04-1530 Anti-MDM2 Antibody, clone 3G9 Anti-MDM2 Antibody, clone 3G9 is a Mouse Monoclonal Antibody for detection of MDM2 also known as Double minute 2 protein or Mdm2 p53 binding protein homolog & has been validated in WB, IP, ICC & IHC. pricing
MABE331 Anti-MDM2 Antibody, clone 4B2C1.11 Use Anti-MDM2 Antibody, clone 4B2C1.11 (mouse monoclonal antibody) validated in WB, IP, ICC to detect MDM2 also known as E3 ubiquitin-protein ligase Mdm2, Double minute 2 protein, Hdm2, Oncoprotein Mdm2, p53-binding protein Mdm2. pricing
MABE340 Anti-MDM2 Antibody, clone IF2 Anti-MDM2 Antibody, clone IF2 is a Mouse Monoclonal Antibody for detection of MDM2 also known as E3 ubiquitin-protein ligase Mdm2 or Hdm2 & has been validated in WB & IHC. pricing
MABE340-AF488 Anti-MDM2 Antibody, clone IF2, Alexa Fluor® 488 Conjugate This Anti-MDM2 Antibody, clone IF2, Alexa Fluor® 488 Conjugate is validated for use in Immunocytochemistry for the detection of MDM2. pricing
MABE340-AF555 Anti-MDM2 Antibody, clone IF2, Alexa Fluor® 555 Conjugate This Anti-MDM2 Antibody, clone IF2, Alexa Fluor® 555 Conjugate is validated for use in Immunocytochemistry for the detection of MDM2. pricing
MAB3776 Anti-MDM2 Antibody, clone SMP14 Use Anti-MDM2 Antibody, clone SMP14 (Mouse Monoclonal Antibody) validated in IP, IHC, IHC(P) to detect MDM2 also known as Murine Double Minute 2. pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002392 Rosetta Predictions human pricing
NM_006878 Rosetta Predictions human pricing
NM_006879 Rosetta Predictions human pricing
NM_006881 Rosetta Predictions human pricing
NM_006882 Rosetta Predictions human pricing
NM_001108099 Rosetta Predictions rat pricing
NM_010786 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002392 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00132038 predicted 288
2 SASI_Hs01_00132040 predicted 314
3 SASI_Hs01_00132041 predicted 301
4 SASI_Hs01_00132043 predicted 307
5 SASI_Hs01_00132044 predicted 313
6 SASI_Hs01_00132045 predicted 280
7 SASI_Hs01_00132046 predicted 280
8 SASI_Hs01_00132047 predicted 300
9 SASI_Hs02_00333750 predicted 284
10 SASI_Hs02_00333751 predicted 298
11 SASI_Hs01_00132039 predicted 295
12 SASI_Hs01_00132042 predicted 287
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006878 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00075502 predicted 288
2 SASI_Hs01_00075504 predicted 314
3 SASI_Hs01_00075505 predicted 301
4 SASI_Hs01_00075507 predicted 311
5 SASI_Hs01_00075508 predicted 304
6 SASI_Hs01_00075509 predicted 281
7 SASI_Hs01_00075510 predicted 287
8 SASI_Hs01_00075511 predicted 304
9 SASI_Hs02_00342530 predicted 278
10 SASI_Hs02_00342531 predicted 297
11 SASI_Hs01_00075503 predicted 292
12 SASI_Hs01_00075506 predicted 293
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006879 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00219996 predicted 281
2 SASI_Hs01_00219998 predicted 313
3 SASI_Hs01_00219999 predicted 301
4 SASI_Hs01_00220001 predicted 302
5 SASI_Hs01_00220002 predicted 307
6 SASI_Hs01_00220003 predicted 275
7 SASI_Hs01_00220004 predicted 281
8 SASI_Hs01_00220005 predicted 306
9 SASI_Hs02_00342532 predicted 285
10 SASI_Hs02_00342533 predicted 296
11 SASI_Hs01_00219997 predicted 295
12 SASI_Hs01_00220000 predicted 289
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006881 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00017084 predicted 283
2 SASI_Hs01_00017086 predicted 311
3 SASI_Hs01_00017087 predicted 298
4 SASI_Hs01_00017089 predicted 305
5 SASI_Hs01_00017090 predicted 305
6 SASI_Hs01_00017091 predicted 277
7 SASI_Hs01_00017092 predicted 284
8 SASI_Hs01_00017093 predicted 307
9 SASI_Hs02_00342534 predicted 281
10 SASI_Hs02_00342535 predicted 299
11 SASI_Hs01_00017085 predicted 295
12 SASI_Hs01_00017088 predicted 297
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006882 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00178047 predicted 282
2 SASI_Hs01_00178049 predicted 309
3 SASI_Hs01_00178050 predicted 301
4 SASI_Hs01_00178052 predicted 306
5 SASI_Hs01_00178053 predicted 311
6 SASI_Hs01_00178054 predicted 282
7 SASI_Hs01_00178055 predicted 280
8 SASI_Hs01_00178056 predicted 304
9 SASI_Hs02_00342536 predicted 277
10 SASI_Hs02_00342537 predicted 296
11 SASI_Hs01_00178048 predicted 289
12 SASI_Hs01_00178051 predicted 293
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108099 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00235344 predicted 864
2 SASI_Rn02_00235345 predicted 1484
3 SASI_Rn02_00235346 predicted 1033
4 SASI_Rn02_00235347 predicted 971
5 SASI_Rn02_00235348 predicted 605
6 SASI_Rn02_00235349 predicted 312
7 SASI_Rn02_00235350 predicted 380
8 SASI_Rn02_00235351 predicted 1425
9 SASI_Rn02_00235352 predicted 884
10 SASI_Rn02_00235353 predicted 802
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010786 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00139357 predicted 623
2 SASI_Mm01_00139359 predicted 518
3 SASI_Mm01_00139360 predicted 461
4 SASI_Mm01_00139361 predicted 1337
5 SASI_Mm01_00139362 predicted 480
6 SASI_Mm01_00139363 predicted 392
7 SASI_Mm01_00139364 predicted 1856
8 SASI_Mm01_00139365 predicted 1116
9 SASI_Mm01_00139366 predicted 490
10 SASI_Mm02_00319354 predicted 586
11 SASI_Mm01_00139358 predicted 469
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002392
MDM2 MISSION shRNA Bacterial Glycerol Stock
MDM2 oncogene, E3 ubiquitin protein ligase
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000355725    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002392.3-827s21c1
Sequence:CCGGATTATCTGGTGAACGACAAAGCTCGAGCTTTGTCGTTCACCAGATAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000355726    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002392.3-1906s21c1
Sequence:CCGGTAGTATAATTGACCTACTTTGCTCGAGCAAAGTAGGTCAATTATACTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003377    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002392.x-1416s1c1
Sequence:CCGGGATTCCAGAGAGTCATGTGTTCTCGAGAACACATGACTCTCTGGAATCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003379    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002392.x-906s1c1
Sequence:CCGGCTGTGTGTAATAAGGGAGATACTCGAGTATCTCCCTTATTACACACAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000355727    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002392.3-1063s21c1
Sequence:CCGGCTCTCGACTCAGAAGATTATACTCGAGTATAATCTTCTGAGTCGAGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003378    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002392.x-504s1c1
Sequence:CCGGCGATTATATGATGAGAAGCAACTCGAGTTGCTTCTCATCATATAATCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003380    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002392.x-1495s1c1
Sequence:CCGGCTCAGCCATCAACTTCTAGTACTCGAGTACTAGAAGTTGATGGCTGAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000355728    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002392.3-1496s21c1
Sequence:CCGGATCAACTTCTAGTAGCATTATCTCGAGATAATGCTACTAGAAGTTGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002392
MDM2 MISSION shRNA shRNA Plasmid DNA
MDM2 oncogene, E3 ubiquitin protein ligase
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000355725    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002392.3-827s21c1
Sequence:CCGGATTATCTGGTGAACGACAAAGCTCGAGCTTTGTCGTTCACCAGATAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000355726    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002392.3-1906s21c1
Sequence:CCGGTAGTATAATTGACCTACTTTGCTCGAGCAAAGTAGGTCAATTATACTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003377    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002392.x-1416s1c1
Sequence:CCGGGATTCCAGAGAGTCATGTGTTCTCGAGAACACATGACTCTCTGGAATCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003379    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002392.x-906s1c1
Sequence:CCGGCTGTGTGTAATAAGGGAGATACTCGAGTATCTCCCTTATTACACACAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000355727    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002392.3-1063s21c1
Sequence:CCGGCTCTCGACTCAGAAGATTATACTCGAGTATAATCTTCTGAGTCGAGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003378    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002392.x-504s1c1
Sequence:CCGGCGATTATATGATGAGAAGCAACTCGAGTTGCTTCTCATCATATAATCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003380    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002392.x-1495s1c1
Sequence:CCGGCTCAGCCATCAACTTCTAGTACTCGAGTACTAGAAGTTGATGGCTGAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000355728    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002392.3-1496s21c1
Sequence:CCGGATCAACTTCTAGTAGCATTATCTCGAGATAATGCTACTAGAAGTTGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002392
MDM2 MISSION shRNA Lentiviral Transduction Particles
MDM2 oncogene, E3 ubiquitin protein ligase
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000355725    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002392.3-827s21c1
Sequence:CCGGATTATCTGGTGAACGACAAAGCTCGAGCTTTGTCGTTCACCAGATAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000355726    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002392.3-1906s21c1
Sequence:CCGGTAGTATAATTGACCTACTTTGCTCGAGCAAAGTAGGTCAATTATACTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003377    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002392.x-1416s1c1
Sequence:CCGGGATTCCAGAGAGTCATGTGTTCTCGAGAACACATGACTCTCTGGAATCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003379    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002392.x-906s1c1
Sequence:CCGGCTGTGTGTAATAAGGGAGATACTCGAGTATCTCCCTTATTACACACAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000355727    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002392.3-1063s21c1
Sequence:CCGGCTCTCGACTCAGAAGATTATACTCGAGTATAATCTTCTGAGTCGAGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003378    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002392.x-504s1c1
Sequence:CCGGCGATTATATGATGAGAAGCAACTCGAGTTGCTTCTCATCATATAATCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003380    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002392.x-1495s1c1
Sequence:CCGGCTCAGCCATCAACTTCTAGTACTCGAGTACTAGAAGTTGATGGCTGAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000355728    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002392.3-1496s21c1
Sequence:CCGGATCAACTTCTAGTAGCATTATCTCGAGATAATGCTACTAGAAGTTGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010786
MDM2 MISSION shRNA Bacterial Glycerol Stock
MDM2 oncogene, E3 ubiquitin protein ligase
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000302274    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010786.3-1687s21c1
Sequence:CCGGCCAATCCAAATGATTGTGCTACTCGAGTAGCACAATCATTTGGATTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000302276    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010786.3-1158s21c1
Sequence:CCGGGTGTACCTCATGCAATGAAATCTCGAGATTTCATTGCATGAGGTACACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000302273    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010786.3-950s21c1
Sequence:CCGGGCCTGGATCAGGATTCAGTTTCTCGAGAAACTGAATCCTGATCCAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000302199    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010786.3-1421s21c1
Sequence:CCGGGTGACGACTATTCCCAACCATCTCGAGATGGTTGGGAATAGTCGTCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039484    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010786.2-1688s1c1
Sequence:CCGGCCAATCCAAATGATTGTGCTACTCGAGTAGCACAATCATTTGGATTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039487    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010786.2-951s1c1
Sequence:CCGGGCCTGGATCAGGATTCAGTTTCTCGAGAAACTGAATCCTGATCCAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039488    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010786.2-1422s1c1
Sequence:CCGGGTGACGACTATTCCCAACCATCTCGAGATGGTTGGGAATAGTCGTCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039486    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010786.2-1159s1c1
Sequence:CCGGGTGTACCTCATGCAATGAAATCTCGAGATTTCATTGCATGAGGTACACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039485    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010786.2-318s1c1
Sequence:CCGGCGGAACAAGAGACTCTGGTTACTCGAGTAACCAGAGTCTCTTGTTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010786
MDM2 MISSION shRNA shRNA Plasmid DNA
MDM2 oncogene, E3 ubiquitin protein ligase
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000302274    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010786.3-1687s21c1
Sequence:CCGGCCAATCCAAATGATTGTGCTACTCGAGTAGCACAATCATTTGGATTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000302276    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010786.3-1158s21c1
Sequence:CCGGGTGTACCTCATGCAATGAAATCTCGAGATTTCATTGCATGAGGTACACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000302273    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010786.3-950s21c1
Sequence:CCGGGCCTGGATCAGGATTCAGTTTCTCGAGAAACTGAATCCTGATCCAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000302199    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010786.3-1421s21c1
Sequence:CCGGGTGACGACTATTCCCAACCATCTCGAGATGGTTGGGAATAGTCGTCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000039484    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010786.2-1688s1c1
Sequence:CCGGCCAATCCAAATGATTGTGCTACTCGAGTAGCACAATCATTTGGATTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000039487    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010786.2-951s1c1
Sequence:CCGGGCCTGGATCAGGATTCAGTTTCTCGAGAAACTGAATCCTGATCCAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000039488    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010786.2-1422s1c1
Sequence:CCGGGTGACGACTATTCCCAACCATCTCGAGATGGTTGGGAATAGTCGTCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000039486    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010786.2-1159s1c1
Sequence:CCGGGTGTACCTCATGCAATGAAATCTCGAGATTTCATTGCATGAGGTACACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000039485    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010786.2-318s1c1
Sequence:CCGGCGGAACAAGAGACTCTGGTTACTCGAGTAACCAGAGTCTCTTGTTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010786
MDM2 MISSION shRNA Lentiviral Transduction Particles
MDM2 oncogene, E3 ubiquitin protein ligase
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000302274    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010786.3-1687s21c1
Sequence:CCGGCCAATCCAAATGATTGTGCTACTCGAGTAGCACAATCATTTGGATTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000302276    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010786.3-1158s21c1
Sequence:CCGGGTGTACCTCATGCAATGAAATCTCGAGATTTCATTGCATGAGGTACACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000302273    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010786.3-950s21c1
Sequence:CCGGGCCTGGATCAGGATTCAGTTTCTCGAGAAACTGAATCCTGATCCAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000302199    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010786.3-1421s21c1
Sequence:CCGGGTGACGACTATTCCCAACCATCTCGAGATGGTTGGGAATAGTCGTCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039484    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010786.2-1688s1c1
Sequence:CCGGCCAATCCAAATGATTGTGCTACTCGAGTAGCACAATCATTTGGATTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039487    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010786.2-951s1c1
Sequence:CCGGGCCTGGATCAGGATTCAGTTTCTCGAGAAACTGAATCCTGATCCAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039488    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010786.2-1422s1c1
Sequence:CCGGGTGACGACTATTCCCAACCATCTCGAGATGGTTGGGAATAGTCGTCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039486    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010786.2-1159s1c1
Sequence:CCGGGTGTACCTCATGCAATGAAATCTCGAGATTTCATTGCATGAGGTACACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039485    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010786.2-318s1c1
Sequence:CCGGCGGAACAAGAGACTCTGGTTACTCGAGTAACCAGAGTCTCTTGTTCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)