EMAIL THIS PAGE TO A FRIEND

MDM4

Mdm4 p53 binding protein homolog (mouse)

86 Gene Product Result for
Synonyms: HDMX MDMX MRP1
UniProtKB ID: O15151, Q2M2Y2, Q32SL2, Q6GS18, Q8IV83
Gene ID:
Human(4194) Summary: This gene encodes a nuclear protein that contains a p53 binding domain at the N-terminus and a RING finger domain at the C-terminus, and shows structural similarity to p53-binding protein MDM2. Both proteins bind the p53 tumor suppressor protein and inhibit its activity, and have been shown to be overexpressed in a variety of human cancers. However, unlike MDM2 which degrades p53, this protein inhibits p53 by binding its transcriptional activation domain. This protein also interacts with MDM2 protein via the RING finger domain, and inhibits the latter's degradation. So this protein can reverse MDM2-targeted degradation of p53, while maintaining suppression of p53 transactivation and apoptotic functions. Alternatively spliced transcript variants encoding different isoforms have been noted for this gene. [provided by RefSeq, Feb 2011]
Mouse(17248) transformed mouse 3T3 cell double minute 4
Rat(304798) Mdm4 p53 binding protein homolog (mouse)
sheep(101112914) Mdm4 p53 binding protein homolog (mouse)
naked mole-rat(101720853) Mdm4 p53 binding protein homolog (mouse)
Domestic Rabbit(100351683) Mdm4 p53 binding protein homolog (mouse)
domestic guinea pig(100719525) Mdm4 p53 binding protein homolog (mouse)
Zebrafish(334932) transformed 3T3 cell double minute 4 homolog (mouse)
cow(514225) Mdm4 p53 binding protein homolog (mouse)
Horse(100050113) Mdm4 p53 binding protein homolog (mouse)
domestic cat(101082460) Mdm4 p53 binding protein homolog (mouse)
dog(478939) Mdm4 p53 binding protein homolog (mouse)
chicken(419823) Mdm4 p53 binding protein homolog (mouse)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1406114 Anti-MDM4 antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
immunofluorescence, western blot pricing
SAB2108301 Anti-MDM4 antibody produced in rabbit affinity isolated antibody horse, human, rabbit
western blot pricing
AV06007 Anti-MDM4 antibody produced in rabbit affinity isolated antibody canine, rabbit, human, bovine, human, horse, pig
western blot pricing
HPA018919 Anti-MDM4 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing
SAB4501852 Anti-MDM4 antibody produced in rabbit affinity isolated antibody rat, human, mouse
ELISA, immunohistochemistry, western blot pricing
HPA048821 Anti-MDM4 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody human
immunofluorescence, western blot pricing
SAB2103899 Anti-MDM4, (N-terminal) antibody produced in rabbit affinity isolated antibody, lyophilized powder rabbit, horse, human
western blot pricing
SAB4504711 Anti-phospho-MDM4 (pSer367) antibody produced in rabbit affinity isolated antibody human, mouse, rat
ELISA, immunohistochemistry, western blot pricing
PLA0297 Goat anti-HdmX/MDM4 Antibody, Affinity Purified Powered by Bethyl Laboratories, Inc. human
immunoprecipitation (IP), proximity ligation assay pricing
M0445 Monoclonal Anti-MDMX antibody produced in mouse clone MDMX-82, purified from hybridoma cell culture human
immunocytochemistry, immunoprecipitation (IP), microarray, western blot pricing
M8070 Monoclonal Anti-phospho-MDMX (pTyr55) antibody produced in mouse ~2 mg/mL, clone PH-MDMX-55, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
M8195 Monoclonal Anti-phospho-MDMX (pTyr99) antibody produced in mouse ~2 mg/mL, clone PH-MDMX-169, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, western blot pricing
PLA0102 Rabbit anti-Phospho HdmX/MDM4 (S403) Antibody, Affinity Purified Powered by Bethyl Laboratories, Inc. human, chimpanzee, marmoset, pig, primate, rabbit, dog, gorilla, guinea pig, horse, bovine
proximity ligation assay, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002393 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002393 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002393 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008575 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008575 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008575 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002393 Rosetta Predictions human pricing
NM_001012026 Rosetta Predictions rat pricing
XM_573450 Rosetta Predictions rat pricing
NM_008575 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002393 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00333752 predicted 286
2 SASI_Hs01_00108581 predicted 1586
3 SASI_Hs02_00333753 predicted 1038
4 SASI_Hs01_00108582 predicted 1274
5 SASI_Hs01_00108583 predicted 540
6 SASI_Hs01_00108584 predicted 808
7 SASI_Hs01_00108585 predicted 1141
8 SASI_Hs01_00108586 predicted 795
9 SASI_Hs01_00108588 predicted 1029
10 SASI_Hs01_00108589 predicted 1184
11 SASI_Hs01_00108587 predicted 331
12 SASI_Hs01_00108590 predicted 326
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012026 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00097521 predicted 269
2 SASI_Rn01_00097522 predicted 1266
3 SASI_Rn01_00097524 predicted 848
4 SASI_Rn01_00097525 predicted 1225
5 SASI_Rn01_00097526 predicted 1478
6 SASI_Rn01_00097527 predicted 354
7 SASI_Rn01_00097528 predicted 426
8 SASI_Rn01_00097529 predicted 1538
9 SASI_Rn02_00200111 predicted 748
10 SASI_Rn02_00200112 predicted 1083
11 SASI_Rn01_00097523 predicted 763
12 SASI_Rn01_00097530 predicted 1454
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_573450 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00156552 predicted 301
2 SASI_Rn01_00156553 predicted 1298
3 SASI_Rn01_00156554 predicted 794
4 SASI_Rn01_00156555 predicted 889
5 SASI_Rn01_00156556 predicted 1261
6 SASI_Rn01_00156557 predicted 1509
7 SASI_Rn01_00156558 predicted 390
8 SASI_Rn01_00156559 predicted 466
9 SASI_Rn01_00156560 predicted 1568
10 SASI_Rn01_00156561 predicted 1474
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008575 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00058093 predicted 367
2 SASI_Mm01_00058095 predicted 1356
3 SASI_Mm01_00058097 predicted 1487
4 SASI_Mm01_00058098 predicted 226
5 SASI_Mm01_00058099 predicted 1324
6 SASI_Mm01_00058100 predicted 1220
7 SASI_Mm01_00058101 predicted 447
8 SASI_Mm01_00058102 predicted 1540
9 SASI_Mm02_00314194 predicted 1089
10 SASI_Mm02_00314195 predicted 728
11 SASI_Mm01_00058094 predicted 957
12 SASI_Mm01_00058096 predicted 546
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002393
VALIDATED
MDM4 MISSION shRNA Bacterial Glycerol Stock
Mdm4 p53 binding protein homolog (mouse)
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000003860    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_002393.x-2003s1c1
Sequence:CCGGACAGTCCTTCAGCTATTTCATCTCGAGATGAAATAGCTGAAGGACTGTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003857    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002393.x-748s1c1
Sequence:CCGGCACCTAGAAGTAATGGCTCAACTCGAGTTGAGCCATTACTTCTAGGTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003859    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_002393.x-1193s1c1
Sequence:CCGGCCCTGATTGTCGAAGAACCATCTCGAGATGGTTCTTCGACAATCAGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003858    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_002393.x-254s1c1
Sequence:CCGGGTTCACTGTTAAAGAGGTCATCTCGAGATGACCTCTTTAACAGTGAACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010825    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002393.x-853s1c1
Sequence:CCGGCAGAGCAGTTAGGTGTTGGAACTCGAGTTCCAACACCTAACTGCTCTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381237    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002393.3-309s21c1
Sequence:GTACCGGTAAAGAGGTCATGCACTATTTCTCGAGAAATAGTGCATGACCTCTTTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000350973    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002393.3-1239s21c1
Sequence:CCGGCCCTGATTGTCGAAGAACCATCTCGAGATGGTTCTTCGACAATCAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000379724    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002393.3-1492s21c1
Sequence:GTACCGGCCACGAGACGGGAACATTATTCTCGAGAATAATGTTCCCGTCTCGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000338315    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002393.3-1632s21c1
Sequence:CCGGATAATGGTAGTACGAACATAACTCGAGTTATGTTCGTACTACCATTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000338317    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002393.3-1277s21c1
Sequence:CCGGGACCTAAAGATGCGTATATAACTCGAGTTATATACGCATCTTTAGGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000338316    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002393.3-1665s21c1
Sequence:CCGGTCCGTTCACTTACCACATTATCTCGAGATAATGTGGTAAGTGAACGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000338381    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002393.3-635s21c1
Sequence:CCGGTGCCTACCTCAGAGCATAAATCTCGAGATTTATGCTCTGAGGTAGGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002393
VALIDATED
MDM4 MISSION shRNA shRNA Plasmid DNA
Mdm4 p53 binding protein homolog (mouse)
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000003860    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_002393.x-2003s1c1
Sequence:CCGGACAGTCCTTCAGCTATTTCATCTCGAGATGAAATAGCTGAAGGACTGTTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003857    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002393.x-748s1c1
Sequence:CCGGCACCTAGAAGTAATGGCTCAACTCGAGTTGAGCCATTACTTCTAGGTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003859    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_002393.x-1193s1c1
Sequence:CCGGCCCTGATTGTCGAAGAACCATCTCGAGATGGTTCTTCGACAATCAGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003858    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_002393.x-254s1c1
Sequence:CCGGGTTCACTGTTAAAGAGGTCATCTCGAGATGACCTCTTTAACAGTGAACTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000010825    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002393.x-853s1c1
Sequence:CCGGCAGAGCAGTTAGGTGTTGGAACTCGAGTTCCAACACCTAACTGCTCTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000381237    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002393.3-309s21c1
Sequence:GTACCGGTAAAGAGGTCATGCACTATTTCTCGAGAAATAGTGCATGACCTCTTTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000350973    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002393.3-1239s21c1
Sequence:CCGGCCCTGATTGTCGAAGAACCATCTCGAGATGGTTCTTCGACAATCAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000379724    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002393.3-1492s21c1
Sequence:GTACCGGCCACGAGACGGGAACATTATTCTCGAGAATAATGTTCCCGTCTCGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000338315    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002393.3-1632s21c1
Sequence:CCGGATAATGGTAGTACGAACATAACTCGAGTTATGTTCGTACTACCATTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000338317    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002393.3-1277s21c1
Sequence:CCGGGACCTAAAGATGCGTATATAACTCGAGTTATATACGCATCTTTAGGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000338316    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002393.3-1665s21c1
Sequence:CCGGTCCGTTCACTTACCACATTATCTCGAGATAATGTGGTAAGTGAACGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000338381    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002393.3-635s21c1
Sequence:CCGGTGCCTACCTCAGAGCATAAATCTCGAGATTTATGCTCTGAGGTAGGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002393
VALIDATED
MDM4 MISSION shRNA Lentiviral Transduction Particles
Mdm4 p53 binding protein homolog (mouse)
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000003860    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_002393.x-2003s1c1
Sequence:CCGGACAGTCCTTCAGCTATTTCATCTCGAGATGAAATAGCTGAAGGACTGTTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003857    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002393.x-748s1c1
Sequence:CCGGCACCTAGAAGTAATGGCTCAACTCGAGTTGAGCCATTACTTCTAGGTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003859    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_002393.x-1193s1c1
Sequence:CCGGCCCTGATTGTCGAAGAACCATCTCGAGATGGTTCTTCGACAATCAGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003858    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_002393.x-254s1c1
Sequence:CCGGGTTCACTGTTAAAGAGGTCATCTCGAGATGACCTCTTTAACAGTGAACTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010825    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002393.x-853s1c1
Sequence:CCGGCAGAGCAGTTAGGTGTTGGAACTCGAGTTCCAACACCTAACTGCTCTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381237    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002393.3-309s21c1
Sequence:GTACCGGTAAAGAGGTCATGCACTATTTCTCGAGAAATAGTGCATGACCTCTTTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000350973    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002393.3-1239s21c1
Sequence:CCGGCCCTGATTGTCGAAGAACCATCTCGAGATGGTTCTTCGACAATCAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000379724    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002393.3-1492s21c1
Sequence:GTACCGGCCACGAGACGGGAACATTATTCTCGAGAATAATGTTCCCGTCTCGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000338315    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002393.3-1632s21c1
Sequence:CCGGATAATGGTAGTACGAACATAACTCGAGTTATGTTCGTACTACCATTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000338317    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002393.3-1277s21c1
Sequence:CCGGGACCTAAAGATGCGTATATAACTCGAGTTATATACGCATCTTTAGGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000338316    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002393.3-1665s21c1
Sequence:CCGGTCCGTTCACTTACCACATTATCTCGAGATAATGTGGTAAGTGAACGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000338381    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002393.3-635s21c1
Sequence:CCGGTGCCTACCTCAGAGCATAAATCTCGAGATTTATGCTCTGAGGTAGGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008575
MDM4 MISSION shRNA Bacterial Glycerol Stock
Mdm4 p53 binding protein homolog (mouse)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000039504    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008575.2-1133s1c1
Sequence:CCGGGCAAGAAGTTTAATTCTCCAACTCGAGTTGGAGAATTAAACTTCTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039505    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008575.2-260s1c1
Sequence:CCGGGCAGAATTTCTTCGGAACAAACTCGAGTTTGTTCCGAAGAAATTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039507    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008575.2-1433s1c1
Sequence:CCGGGCGCGAGAGAACAAACAGATACTCGAGTATCTGTTTGTTCTCTCGCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039508    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008575.2-858s1c1
Sequence:CCGGCTCAACTGATTTACAGACAAACTCGAGTTTGTCTGTAAATCAGTTGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039506    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008575.2-1288s1c1
Sequence:CCGGCCCGATTGTAGGAGAACCATTCTCGAGAATGGTTCTCCTACAATCGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008575
MDM4 MISSION shRNA shRNA Plasmid DNA
Mdm4 p53 binding protein homolog (mouse)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000039504    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008575.2-1133s1c1
Sequence:CCGGGCAAGAAGTTTAATTCTCCAACTCGAGTTGGAGAATTAAACTTCTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000039505    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008575.2-260s1c1
Sequence:CCGGGCAGAATTTCTTCGGAACAAACTCGAGTTTGTTCCGAAGAAATTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000039507    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008575.2-1433s1c1
Sequence:CCGGGCGCGAGAGAACAAACAGATACTCGAGTATCTGTTTGTTCTCTCGCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000039508    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008575.2-858s1c1
Sequence:CCGGCTCAACTGATTTACAGACAAACTCGAGTTTGTCTGTAAATCAGTTGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000039506    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008575.2-1288s1c1
Sequence:CCGGCCCGATTGTAGGAGAACCATTCTCGAGAATGGTTCTCCTACAATCGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008575
MDM4 MISSION shRNA Lentiviral Transduction Particles
Mdm4 p53 binding protein homolog (mouse)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000039504    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008575.2-1133s1c1
Sequence:CCGGGCAAGAAGTTTAATTCTCCAACTCGAGTTGGAGAATTAAACTTCTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039505    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008575.2-260s1c1
Sequence:CCGGGCAGAATTTCTTCGGAACAAACTCGAGTTTGTTCCGAAGAAATTCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039507    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008575.2-1433s1c1
Sequence:CCGGGCGCGAGAGAACAAACAGATACTCGAGTATCTGTTTGTTCTCTCGCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039508    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008575.2-858s1c1
Sequence:CCGGCTCAACTGATTTACAGACAAACTCGAGTTTGTCTGTAAATCAGTTGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039506    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008575.2-1288s1c1
Sequence:CCGGCCCGATTGTAGGAGAACCATTCTCGAGAATGGTTCTCCTACAATCGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)