EMAIL THIS PAGE TO A FRIEND

MDN1

MDN1, midasin homolog (yeast)

104 Gene Product Result for
UniProtKB ID: Q9NU22, O15019, Q5T794
Gene ID:
Mouse(100019) midasin homolog (yeast)
Rat(362498) midasin homolog (yeast)
sheep(101109364) MDN1, midasin homolog (yeast)
domestic guinea pig(100715023) MDN1, midasin homolog (yeast)
naked mole-rat(101720727) MDN1, midasin homolog (yeast)
Zebrafish(555704) midasin homolog (yeast)
chicken(421811) MDN1, midasin homolog (yeast)
domestic cat(101095173) MDN1, midasin homolog (yeast)
cow(535163) MDN1, midasin homolog (yeast)
dog(474995) MDN1, midasin homolog (yeast)
Gene Class: ATPase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001081392 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001081392 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001081392 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_014611 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014611 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014611 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014611 Rosetta Predictions human pricing
NM_001081392 Rosetta Predictions mouse pricing
XM_975211 Rosetta Predictions mouse pricing
XM_975241 Rosetta Predictions mouse pricing
XM_975310 Rosetta Predictions mouse pricing
XM_975343 Rosetta Predictions mouse pricing
XM_975375 Rosetta Predictions mouse pricing
XM_975416 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014611 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00345893 predicted 14287
2 SASI_Hs01_00198038 predicted 2180
3 SASI_Hs01_00198039 predicted 16573
4 SASI_Hs01_00198040 predicted 7695
5 SASI_Hs01_00198042 predicted 14908
6 SASI_Hs02_00345894 predicted 10680
7 SASI_Hs01_00198045 predicted 9442
8 SASI_Hs02_00345895 predicted 4177
9 SASI_Hs02_00345896 predicted 8920
10 SASI_Hs02_00345897 predicted 1468
11 SASI_Hs01_00198037 predicted 1532
12 SASI_Hs01_00198041 predicted 15668
13 SASI_Hs01_00198043 predicted 1493
14 SASI_Hs01_00198044 predicted 16216
15 SASI_Hs01_00198046 predicted 6359
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081392 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00297951 predicted 6353
2 SASI_Mm02_00297952 predicted 4916
3 SASI_Mm02_00297953 predicted 6636
4 SASI_Mm02_00297954 predicted 13460
5 SASI_Mm02_00297955 predicted 13534
6 SASI_Mm02_00297956 predicted 7691
7 SASI_Mm02_00297957 predicted 4717
8 SASI_Mm02_00297958 predicted 11383
9 SASI_Mm02_00297959 predicted 16110
10 SASI_Mm02_00297960 predicted 9821
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_975211 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00250775 predicted 257
2 SASI_Mm01_00250776 predicted 303
3 SASI_Mm01_00250777 predicted 298
4 SASI_Mm01_00250778 predicted 280
5 SASI_Mm01_00250779 predicted 253
6 SASI_Mm01_00250780 predicted 280
7 SASI_Mm01_00250781 predicted 221
8 SASI_Mm01_00250782 predicted 226
9 SASI_Mm01_00250783 predicted 268
10 SASI_Mm01_00250784 predicted 202
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_975241 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00261603 predicted 932
2 SASI_Mm01_00261604 predicted 1311
3 SASI_Mm01_00261605 predicted 779
4 SASI_Mm01_00261606 predicted 1065
5 SASI_Mm01_00261607 predicted 1174
6 SASI_Mm01_00261608 predicted 1635
7 SASI_Mm01_00261609 predicted 1629
8 SASI_Mm01_00261610 predicted 1066
9 SASI_Mm01_00261611 predicted 802
10 SASI_Mm01_00261612 predicted 978
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_975310 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00284037 predicted 6357
2 SASI_Mm01_00284038 predicted 4929
3 SASI_Mm01_00284039 predicted 6639
4 SASI_Mm01_00284040 predicted 13464
5 SASI_Mm01_00284041 predicted 12724
6 SASI_Mm01_00284042 predicted 7695
7 SASI_Mm01_00284043 predicted 12359
8 SASI_Mm01_00284044 predicted 4721
9 SASI_Mm01_00284045 predicted 11383
10 SASI_Mm01_00284046 predicted 16118
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_975343 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00254007 predicted 352
2 SASI_Mm01_00254008 predicted 584
3 SASI_Mm01_00254009 predicted 670
4 SASI_Mm01_00254010 predicted 465
5 SASI_Mm01_00254011 predicted 399
6 SASI_Mm01_00254012 predicted 691
7 SASI_Mm01_00254013 predicted 640
8 SASI_Mm01_00254014 predicted 678
9 SASI_Mm01_00254015 predicted 552
10 SASI_Mm01_00254016 predicted 669
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_975375 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00210002 predicted 301
2 SASI_Mm01_00210003 predicted 337
3 SASI_Mm01_00210004 predicted 258
4 SASI_Mm01_00210005 predicted 400
5 SASI_Mm01_00210006 predicted 527
6 SASI_Mm01_00210007 predicted 303
7 SASI_Mm01_00210008 predicted 891
8 SASI_Mm01_00210009 predicted 388
9 SASI_Mm01_00210010 predicted 454
10 SASI_Mm01_00210011 predicted 157
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_975416 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00270388 predicted 3329
2 SASI_Mm01_00270389 predicted 3850
3 SASI_Mm01_00270390 predicted 2188
4 SASI_Mm01_00270391 predicted 2820
5 SASI_Mm01_00270392 predicted 3460
6 SASI_Mm01_00270393 predicted 3202
7 SASI_Mm01_00270394 predicted 3476
8 SASI_Mm01_00270395 predicted 758
9 SASI_Mm01_00270396 predicted 2257
10 SASI_Mm01_00270397 predicted 3721
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001081392
VALIDATED
MDN1 MISSION shRNA Bacterial Glycerol Stock
MDN1, midasin homolog (yeast)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000265269    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081392.1-2276s21c1
Sequence:CCGGCAGTGGACCATAAGCTTATTTCTCGAGAAATAAGCTTATGGTCCACTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251079    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081392.1-17789s21c1
Sequence:CCGGTGAAGTGTGCCACCCTTATATCTCGAGATATAAGGGTGGCACACTTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251081    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081392.1-575s21c1
Sequence:CCGGTAATGGAAGCAGCCAATATATCTCGAGATATATTGGCTGCTTCCATTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251082    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081392.1-459s21c1
Sequence:CCGGTCCGTTTGCCCTGCGCTATTTCTCGAGAAATAGCGCAGGGCAAACGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251080    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081392.1-9838s21c1
Sequence:CCGGGCGGTGAAGAAGGCATATAAACTCGAGTTTATATGCCTTCTTCACCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001081392
VALIDATED
MDN1 MISSION shRNA shRNA Plasmid DNA
MDN1, midasin homolog (yeast)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000265269    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081392.1-2276s21c1
Sequence:CCGGCAGTGGACCATAAGCTTATTTCTCGAGAAATAAGCTTATGGTCCACTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000251079    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081392.1-17789s21c1
Sequence:CCGGTGAAGTGTGCCACCCTTATATCTCGAGATATAAGGGTGGCACACTTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000251081    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081392.1-575s21c1
Sequence:CCGGTAATGGAAGCAGCCAATATATCTCGAGATATATTGGCTGCTTCCATTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000251082    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081392.1-459s21c1
Sequence:CCGGTCCGTTTGCCCTGCGCTATTTCTCGAGAAATAGCGCAGGGCAAACGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000251080    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081392.1-9838s21c1
Sequence:CCGGGCGGTGAAGAAGGCATATAAACTCGAGTTTATATGCCTTCTTCACCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001081392
VALIDATED
MDN1 MISSION shRNA Lentiviral Transduction Particles
MDN1, midasin homolog (yeast)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000265269    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081392.1-2276s21c1
Sequence:CCGGCAGTGGACCATAAGCTTATTTCTCGAGAAATAAGCTTATGGTCCACTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251079    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081392.1-17789s21c1
Sequence:CCGGTGAAGTGTGCCACCCTTATATCTCGAGATATAAGGGTGGCACACTTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251081    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081392.1-575s21c1
Sequence:CCGGTAATGGAAGCAGCCAATATATCTCGAGATATATTGGCTGCTTCCATTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251082    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081392.1-459s21c1
Sequence:CCGGTCCGTTTGCCCTGCGCTATTTCTCGAGAAATAGCGCAGGGCAAACGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251080    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081392.1-9838s21c1
Sequence:CCGGGCGGTGAAGAAGGCATATAAACTCGAGTTTATATGCCTTCTTCACCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014611
VALIDATED
MDN1 MISSION shRNA Bacterial Glycerol Stock
MDN1, midasin homolog (yeast)
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000229952    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_014611.1-2736s21c1
Sequence:CCGGCATCCTGACTTCCGTTTATTTCTCGAGAAATAAACGGAAGTCAGGATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229954    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014611.1-7486s21c1
Sequence:CCGGATGGACAGATCTTAGTATATTCTCGAGAATATACTAAGATCTGTCCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218331    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 2 Clone ID:NM_014611.1-16918s21c1
Sequence:GTACCGGAGAGTCCAAAGTGAGACTTAACTCGAGTTAAGTCTCACTTTGGACTCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218487    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014611.1-2246s21c1
Sequence:GTACCGGAGACTTGCTTGGAGGTTATAACTCGAGTTATAACCTCCAAGCAAGTCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229953    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_014611.1-3422s21c1
Sequence:CCGGCAACCACTGTGTGCGTATTAACTCGAGTTAATACGCACACAGTGGTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000138916    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014611.1-14292s1c1
Sequence:CCGGGCCATTGAGATGTCGGAAGATCTCGAGATCTTCCGACATCTCAATGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136876    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014611.1-12463s1c1
Sequence:CCGGCCAAGCACATTCTCATGCAAACTCGAGTTTGCATGAGAATGTGCTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136629    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014611.1-16930s1c1
Sequence:CCGGGAGACTTAACTGTGGTCAGAACTCGAGTTCTGACCACAGTTAAGTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136951    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014611.1-14282s1c1
Sequence:CCGGCGAGGATAATGCCATTGAGATCTCGAGATCTCAATGGCATTATCCTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000138839    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_014611.1-17137s1c1
Sequence:CCGGGTTATCCTTCTTCCCTGCCTTCTCGAGAAGGCAGGGAAGAAGGATAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137307    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014611.1-13256s1c1
Sequence:CCGGGCAACAGTCAACTACGAGATTCTCGAGAATCTCGTAGTTGACTGTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014611
VALIDATED
MDN1 MISSION shRNA shRNA Plasmid DNA
MDN1, midasin homolog (yeast)
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000229952    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_014611.1-2736s21c1
Sequence:CCGGCATCCTGACTTCCGTTTATTTCTCGAGAAATAAACGGAAGTCAGGATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000229954    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014611.1-7486s21c1
Sequence:CCGGATGGACAGATCTTAGTATATTCTCGAGAATATACTAAGATCTGTCCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000218331    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 2 Clone ID:NM_014611.1-16918s21c1
Sequence:GTACCGGAGAGTCCAAAGTGAGACTTAACTCGAGTTAAGTCTCACTTTGGACTCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000218487    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014611.1-2246s21c1
Sequence:GTACCGGAGACTTGCTTGGAGGTTATAACTCGAGTTATAACCTCCAAGCAAGTCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000229953    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_014611.1-3422s21c1
Sequence:CCGGCAACCACTGTGTGCGTATTAACTCGAGTTAATACGCACACAGTGGTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000138916    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014611.1-14292s1c1
Sequence:CCGGGCCATTGAGATGTCGGAAGATCTCGAGATCTTCCGACATCTCAATGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000136876    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014611.1-12463s1c1
Sequence:CCGGCCAAGCACATTCTCATGCAAACTCGAGTTTGCATGAGAATGTGCTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000136629    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014611.1-16930s1c1
Sequence:CCGGGAGACTTAACTGTGGTCAGAACTCGAGTTCTGACCACAGTTAAGTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000136951    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014611.1-14282s1c1
Sequence:CCGGCGAGGATAATGCCATTGAGATCTCGAGATCTCAATGGCATTATCCTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000138839    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_014611.1-17137s1c1
Sequence:CCGGGTTATCCTTCTTCCCTGCCTTCTCGAGAAGGCAGGGAAGAAGGATAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000137307    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014611.1-13256s1c1
Sequence:CCGGGCAACAGTCAACTACGAGATTCTCGAGAATCTCGTAGTTGACTGTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014611
VALIDATED
MDN1 MISSION shRNA Lentiviral Transduction Particles
MDN1, midasin homolog (yeast)
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000229952    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_014611.1-2736s21c1
Sequence:CCGGCATCCTGACTTCCGTTTATTTCTCGAGAAATAAACGGAAGTCAGGATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229954    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014611.1-7486s21c1
Sequence:CCGGATGGACAGATCTTAGTATATTCTCGAGAATATACTAAGATCTGTCCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218331    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 2 Clone ID:NM_014611.1-16918s21c1
Sequence:GTACCGGAGAGTCCAAAGTGAGACTTAACTCGAGTTAAGTCTCACTTTGGACTCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218487    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014611.1-2246s21c1
Sequence:GTACCGGAGACTTGCTTGGAGGTTATAACTCGAGTTATAACCTCCAAGCAAGTCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229953    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_014611.1-3422s21c1
Sequence:CCGGCAACCACTGTGTGCGTATTAACTCGAGTTAATACGCACACAGTGGTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000138916    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014611.1-14292s1c1
Sequence:CCGGGCCATTGAGATGTCGGAAGATCTCGAGATCTTCCGACATCTCAATGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136876    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014611.1-12463s1c1
Sequence:CCGGCCAAGCACATTCTCATGCAAACTCGAGTTTGCATGAGAATGTGCTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136629    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014611.1-16930s1c1
Sequence:CCGGGAGACTTAACTGTGGTCAGAACTCGAGTTCTGACCACAGTTAAGTCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136951    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014611.1-14282s1c1
Sequence:CCGGCGAGGATAATGCCATTGAGATCTCGAGATCTCAATGGCATTATCCTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000138839    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_014611.1-17137s1c1
Sequence:CCGGGTTATCCTTCTTCCCTGCCTTCTCGAGAAGGCAGGGAAGAAGGATAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137307    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014611.1-13256s1c1
Sequence:CCGGGCAACAGTCAACTACGAGATTCTCGAGAATCTCGTAGTTGACTGTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)