EMAIL THIS PAGE TO A FRIEND

MDP1

magnesium-dependent phosphatase 1

69 Gene Product Result for
Synonyms: FN6PASE MDP-1
UniProtKB ID: Q86V88, Q86Y84, Q8NAD9
Gene ID:
Mouse(67881) magnesium-dependent phosphatase 1
Rat(290230) magnesium-dependent phosphatase 1
domestic cat(101081306) magnesium-dependent phosphatase 1
dog(480264) magnesium-dependent phosphatase 1-like
domestic guinea pig(100713025) magnesium-dependent phosphatase 1
sheep(101115461) magnesium-dependent phosphatase 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_023397 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_023397 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_023397 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_138476 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_138476 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_138476 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_138476 Rosetta Predictions human pricing
NM_001106039 Rosetta Predictions rat pricing
NM_023397 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138476 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00088404 predicted 336
2 SASI_Hs01_00088405 predicted 451
3 SASI_Hs01_00088406 predicted 373
4 SASI_Hs01_00088407 predicted 274
5 SASI_Hs01_00088408 predicted 411
6 SASI_Hs01_00088409 predicted 342
7 SASI_Hs01_00088410 predicted 301
8 SASI_Hs01_00088411 predicted 371
9 SASI_Hs01_00088412 predicted 276
10 SASI_Hs01_00088413 predicted 195
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106039 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00215022 predicted 215
2 SASI_Rn02_00215023 predicted 1071
3 SASI_Rn02_00215024 predicted 1056
4 SASI_Rn02_00215025 predicted 517
5 SASI_Rn02_00215026 predicted 984
6 SASI_Rn02_00215027 predicted 422
7 SASI_Rn02_00215028 predicted 461
8 SASI_Rn02_00215029 predicted 1082
9 SASI_Rn02_00215030 predicted 242
10 SASI_Rn02_00215031 predicted 493
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_023397 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00119055 predicted 890
2 SASI_Mm01_00119056 predicted 401
3 SASI_Mm01_00119057 predicted 897
4 SASI_Mm01_00119058 predicted 302
5 SASI_Mm02_00327096 predicted 394
6 SASI_Mm01_00119059 predicted 506
7 SASI_Mm01_00119061 predicted 488
8 SASI_Mm01_00119062 predicted 1005
9 SASI_Mm01_00119063 predicted 372
10 SASI_Mm01_00119064 predicted 548
11 SASI_Mm01_00119060 predicted 520
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_023397
VALIDATED
MDP1 MISSION shRNA Bacterial Glycerol Stock
magnesium-dependent phosphatase 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000121002    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_023397.3-782s1c1
Sequence:CCGGGCTGTGAGTTACCATGTGGTTCTCGAGAACCACATGGTAACTCACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121006    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023397.3-366s1c1
Sequence:CCGGCTTTGAGAGGTTGCACCACAACTCGAGTTGTGGTGCAACCTCTCAAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121003    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023397.3-412s1c1
Sequence:CCGGGTCTTCTTTGATGATGAGAATCTCGAGATTCTCATCATCAAAGAAGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121004    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023397.3-498s1c1
Sequence:CCGGTCAAACGTTAACTCAAGGATTCTCGAGAATCCTTGAGTTAACGTTTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121005    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023397.3-508s1c1
Sequence:CCGGACTCAAGGATTAGAGACATTTCTCGAGAAATGTCTCTAATCCTTGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000350894    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023397.3-321s21c1
Sequence:CCGGATACTTTATTCAGCGGGAAATCTCGAGATTTCCCGCTGAATAAAGTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000338149    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023397.3-508s21c1
Sequence:CCGGACTCAAGGATTAGAGACATTTCTCGAGAAATGTCTCTAATCCTTGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000338141    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023397.3-366s21c1
Sequence:CCGGCTTTGAGAGGTTGCACCACAACTCGAGTTGTGGTGCAACCTCTCAAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000338144    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_023397.3-658s21c1
Sequence:CCGGTGCCACCGTATGGGTTGTTTCCTCGAGGAAACAACCCATACGGTGGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000338142    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023397.3-412s21c1
Sequence:CCGGGTCTTCTTTGATGATGAGAATCTCGAGATTCTCATCATCAAAGAAGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_023397
VALIDATED
MDP1 MISSION shRNA shRNA Plasmid DNA
magnesium-dependent phosphatase 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000121002    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_023397.3-782s1c1
Sequence:CCGGGCTGTGAGTTACCATGTGGTTCTCGAGAACCACATGGTAACTCACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000121006    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023397.3-366s1c1
Sequence:CCGGCTTTGAGAGGTTGCACCACAACTCGAGTTGTGGTGCAACCTCTCAAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000121003    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023397.3-412s1c1
Sequence:CCGGGTCTTCTTTGATGATGAGAATCTCGAGATTCTCATCATCAAAGAAGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000121004    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023397.3-498s1c1
Sequence:CCGGTCAAACGTTAACTCAAGGATTCTCGAGAATCCTTGAGTTAACGTTTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000121005    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023397.3-508s1c1
Sequence:CCGGACTCAAGGATTAGAGACATTTCTCGAGAAATGTCTCTAATCCTTGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000350894    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023397.3-321s21c1
Sequence:CCGGATACTTTATTCAGCGGGAAATCTCGAGATTTCCCGCTGAATAAAGTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000338149    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023397.3-508s21c1
Sequence:CCGGACTCAAGGATTAGAGACATTTCTCGAGAAATGTCTCTAATCCTTGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000338141    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023397.3-366s21c1
Sequence:CCGGCTTTGAGAGGTTGCACCACAACTCGAGTTGTGGTGCAACCTCTCAAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000338144    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_023397.3-658s21c1
Sequence:CCGGTGCCACCGTATGGGTTGTTTCCTCGAGGAAACAACCCATACGGTGGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000338142    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023397.3-412s21c1
Sequence:CCGGGTCTTCTTTGATGATGAGAATCTCGAGATTCTCATCATCAAAGAAGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_023397
VALIDATED
MDP1 MISSION shRNA Lentiviral Transduction Particles
magnesium-dependent phosphatase 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000121002    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_023397.3-782s1c1
Sequence:CCGGGCTGTGAGTTACCATGTGGTTCTCGAGAACCACATGGTAACTCACAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121006    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023397.3-366s1c1
Sequence:CCGGCTTTGAGAGGTTGCACCACAACTCGAGTTGTGGTGCAACCTCTCAAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121003    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023397.3-412s1c1
Sequence:CCGGGTCTTCTTTGATGATGAGAATCTCGAGATTCTCATCATCAAAGAAGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121004    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023397.3-498s1c1
Sequence:CCGGTCAAACGTTAACTCAAGGATTCTCGAGAATCCTTGAGTTAACGTTTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121005    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023397.3-508s1c1
Sequence:CCGGACTCAAGGATTAGAGACATTTCTCGAGAAATGTCTCTAATCCTTGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000350894    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023397.3-321s21c1
Sequence:CCGGATACTTTATTCAGCGGGAAATCTCGAGATTTCCCGCTGAATAAAGTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000338149    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023397.3-508s21c1
Sequence:CCGGACTCAAGGATTAGAGACATTTCTCGAGAAATGTCTCTAATCCTTGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000338141    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023397.3-366s21c1
Sequence:CCGGCTTTGAGAGGTTGCACCACAACTCGAGTTGTGGTGCAACCTCTCAAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000338144    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_023397.3-658s21c1
Sequence:CCGGTGCCACCGTATGGGTTGTTTCCTCGAGGAAACAACCCATACGGTGGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000338142    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023397.3-412s21c1
Sequence:CCGGGTCTTCTTTGATGATGAGAATCTCGAGATTCTCATCATCAAAGAAGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_138476
VALIDATED
MDP1 MISSION shRNA Bacterial Glycerol Stock
magnesium-dependent phosphatase 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000149906    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_138476.2-380s1c1
Sequence:CCGGGATCACACACTTTGAGAGGTTCTCGAGAACCTCTCAAAGTGTGTGATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148437    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138476.2-526s1c1
Sequence:CCGGCTCTAAGTCAAGGGTTAGAGACTCGAGTCTCTAACCCTTGACTTAGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147174    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_138476.2-428s1c1
Sequence:CCGGCCAGATGATCTTCTTTGATGACTCGAGTCATCAAAGAAGATCATCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146571    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138476.2-503s1c1
Sequence:CCGGCCAGAATGGAATGAATCTTCACTCGAGTGAAGATTCATTCCATTCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146415    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_138476.2-335s1c1
Sequence:CCGGCCTCTTCAGGTACTTTGTTCACTCGAGTGAACAAAGTACCTGAAGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146672    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_138476.2-347s1c1
Sequence:CCGGCTTTGTTCATCGGGAAATCTACTCGAGTAGATTTCCCGATGAACAAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147797    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_138476.2-344s1c1
Sequence:CCGGGTACTTTGTTCATCGGGAAATCTCGAGATTTCCCGATGAACAAAGTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149258    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_138476.2-282s1c1
Sequence:CCGGGCTTCAAGGACAAGTGAGATACTCGAGTATCTCACTTGTCCTTGAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149118    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_138476.2-333s1c1
Sequence:CCGGGACCTCTTCAGGTACTTTGTTCTCGAGAACAAAGTACCTGAAGAGGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_138476
VALIDATED
MDP1 MISSION shRNA shRNA Plasmid DNA
magnesium-dependent phosphatase 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000149906    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_138476.2-380s1c1
Sequence:CCGGGATCACACACTTTGAGAGGTTCTCGAGAACCTCTCAAAGTGTGTGATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000148437    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138476.2-526s1c1
Sequence:CCGGCTCTAAGTCAAGGGTTAGAGACTCGAGTCTCTAACCCTTGACTTAGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000147174    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_138476.2-428s1c1
Sequence:CCGGCCAGATGATCTTCTTTGATGACTCGAGTCATCAAAGAAGATCATCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000146571    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138476.2-503s1c1
Sequence:CCGGCCAGAATGGAATGAATCTTCACTCGAGTGAAGATTCATTCCATTCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000146415    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_138476.2-335s1c1
Sequence:CCGGCCTCTTCAGGTACTTTGTTCACTCGAGTGAACAAAGTACCTGAAGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000146672    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_138476.2-347s1c1
Sequence:CCGGCTTTGTTCATCGGGAAATCTACTCGAGTAGATTTCCCGATGAACAAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000147797    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_138476.2-344s1c1
Sequence:CCGGGTACTTTGTTCATCGGGAAATCTCGAGATTTCCCGATGAACAAAGTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000149258    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_138476.2-282s1c1
Sequence:CCGGGCTTCAAGGACAAGTGAGATACTCGAGTATCTCACTTGTCCTTGAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000149118    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_138476.2-333s1c1
Sequence:CCGGGACCTCTTCAGGTACTTTGTTCTCGAGAACAAAGTACCTGAAGAGGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_138476
VALIDATED
MDP1 MISSION shRNA Lentiviral Transduction Particles
magnesium-dependent phosphatase 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000149906    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_138476.2-380s1c1
Sequence:CCGGGATCACACACTTTGAGAGGTTCTCGAGAACCTCTCAAAGTGTGTGATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148437    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138476.2-526s1c1
Sequence:CCGGCTCTAAGTCAAGGGTTAGAGACTCGAGTCTCTAACCCTTGACTTAGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147174    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_138476.2-428s1c1
Sequence:CCGGCCAGATGATCTTCTTTGATGACTCGAGTCATCAAAGAAGATCATCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146571    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138476.2-503s1c1
Sequence:CCGGCCAGAATGGAATGAATCTTCACTCGAGTGAAGATTCATTCCATTCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146415    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_138476.2-335s1c1
Sequence:CCGGCCTCTTCAGGTACTTTGTTCACTCGAGTGAACAAAGTACCTGAAGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146672    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_138476.2-347s1c1
Sequence:CCGGCTTTGTTCATCGGGAAATCTACTCGAGTAGATTTCCCGATGAACAAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147797    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_138476.2-344s1c1
Sequence:CCGGGTACTTTGTTCATCGGGAAATCTCGAGATTTCCCGATGAACAAAGTACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149258    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_138476.2-282s1c1
Sequence:CCGGGCTTCAAGGACAAGTGAGATACTCGAGTATCTCACTTGTCCTTGAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149118    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_138476.2-333s1c1
Sequence:CCGGGACCTCTTCAGGTACTTTGTTCTCGAGAACAAAGTACCTGAAGAGGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)